S03036-01_K15
Seqid S03036-01_K15
Sequence >S03036-01_K15.phd
NNTNNNNNNTNNNNNNNCNCCNNNCANNNNNGAAGATTGGCGGCCGAATCGGCCGAATTG
AAGGATAACAAACATCTTCTTTCGTTCGCTTCAAAATAACTACAAATTAAAAATGCAATT
CTCTACCGTCGCTTCTATCGCTGCTATTGCCGCTGTTGCCTCCGCCGCTTCTAACATTAC
CACTGCTACTGTCACAGAAGAATCTACCACTTTGGTCACTATCACTTCCTGTGAGGACCA
CGTTTGTTCTGAAACAGTTTCCCCAGCTTTGGTTTCCACTGCTACCGTCACCGTAAATGA
CGTTATCACTCAATACACCACCTGGTGTCCATTGCCAACCACTGAAGCACCAAAGAATAC
CACTTCTCCAGCTCCAACTGAAAAGCCAACCGAAAAGCCAACTGAAAAGCCAACTGAAAA
GCCAACCCAACAAGGTTCTAGCACTCAAACTGTTACCTCCTACACTGGTGCCGCTGTTAA
GGCTTTGCCAGCTGCCGGTGCTTTGTTGGCTGGTGCTGCCGCTTTATTGTTGTAATTTAC
TCAACCTTTTCTTTAATATATTTTTAGAAAAATGGTTAAGTACTTTTCCNNCAATGCGGC
GNCCACAGNNTAGTGGTATTTTAATTTATAGATATTCTGGAAATTNNNAAAATNAAATNC
TNNGAAGTNNCACTCCATAACAAAAATGTTTATTATGANNNTTTTAATNTAAAGTNNNTG
TCCCATANNNNCCCCNCCNCCTAAACTNNNATTTTNTGTNAAAGAAAAGAAATAAAATAT
TTTTAAACATTATAANCAAAANNAGANNAAANAAANAAAGTAAGNTTNAGTGACCCTCTG
TNNCTAAAANCNGGGANAGNCAAAANAANNAATGTNGNGGNNNAGNAAGNNNNCCCCTCC
CCACNAATAAATGAACGG
Quality >S03036-01_K15.phd
7 4 11 4 5 3 2 3 6 9 6 4 3 3 5 6 7
9 6 13 15 6 5 7 9 8 5 3 3 7 6 11 8 9
12 10 8 9 14 10 13 29 27 9 15 9 9 15 26 27 37
25 28 35 31 29 11 25 35 24 14 16 18 41 17 11 31 29
46 30 28 40 36 30 41 49 49 49 49 46 40 31 42 42 40
42 49 36 38 41 42 30 29 31 43 35 30 28 26 36 35 36
43 30 32 35 35 27 28 26 28 32 35 30 38 37 35 37 47
53 53 51 47 42 49 51 51 51 49 46 43 54 49 34 42 43
44 51 43 37 51 53 53 53 45 50 50 49 50 50 49 49 51
45 57 57 53 51 51 53 53 53 53 49 53 53 51 53 53 53
50 44 49 60 57 54 63 58 51 58 58 50 58 51 58 60 45
60 63 63 63 59 57 60 60 49 58 63 49 50 63 50 57 54
50 60 50 44 47 50 49 60 50 45 50 54 51 50 45 52 52
57 52 57 52 60 57 60 52 43 57 52 52 52 52 60 48 38
57 60 52 57 57 60 57 60 57 58 63 63 63 63 63 58 60
52 63 60 60 57 60 60 58 57 57 57 60 57 60 57 53 52
57 60 53 57 52 52 53 57 63 60 52 60 48 48 60 57 57
52 52 60 57 52 60 57 57 52 57 52 52 57 57 57 57 57
57 57 57 57 52 57 58 57 63 60 60 58 58 60 58 63 58
63 63 53 63 57 57 52 57 52 57 60 57 52 52 60 57 57
57 53 52 52 52 60 60 60 52 43 35 35 32 23 23 43 40
35 34 52 40 40 43 60 57 60 57 57 52 52 52 60 54 57
52 46 57 52 57 57 52 57 57 60 57 52 52 57 60 57 60
57 53 63 63 48 57 52 57 60 57 57 57 52 52 57 48 60
57 57 52 57 57 60 57 52 52 57 57 60 57 52 52 47 57
57 43 43 47 57 60 60 60 57 58 60 60 57 48 48 57 57
57 52 57 52 60 53 57 60 60 60 57 52 57 52 52 52 52
60 52 57 60 47 35 48 52 57 40 57 37 43 40 40 52 52
47 57 48 43 42 52 42 60 52 52 57 52 48 40 42 57 57
60 47 32 35 42 48 48 60 48 43 43 43 40 57 60 43 43
48 48 60 42 60 60 52 52 52 48 40 43 60 57 60 52 44
57 48 20 46 40 21 16 35 37 36 48 47 35 20 32 42 39
29 35 40 52 60 47 35 21 48 43 24 36 47 47 42 31 35
41 41 39 35 41 35 46 40 30 21 28 24 28 24 14 28 19
20 9 12 16 18 18 29 30 24 18 23 5 6 24 20 23 12
9 9 9 11 11 11 6 9 11 11 9 9 9 7 7 10 9
9 9 9 9 8 12 9 27 14 9 9 20 23 13 8 9 9
11 16 27 16 26 20 16 20 9 21 32 9 24 32 13 20 6
7 6 10 11 29 10 10 6 9 11 35 11 7 9 10 6 6
22 14 8 9 9 6 6 9 9 13 10 18 28 9 14 26 19
10 9 12 12 27 9 9 18 9 11 10 9 9 9 16 10 11
10 6 6 6 12 10 17 46 29 35 11 6 16 14 11 9 9
11 6 6 6 9 9 15 21 13 13 12 11 9 6 6 6 6
8 16 9 9 6 13 9 7 9 16 13 17 20 13 9 9 6
6 6 9 9 8 11 8 6 10 9 9 6 11 10 9 10 20
9 19 31 8 28 23 16 15 13 10 17 20 14 11 16 13 18
11 10 9 13 8 9 13 10 9 8 8 10 11 6 8 10 41
40 11 7 7 16 9 11 7 6 9 12 11 6 13 10 9 7
10 23 12 11 9 9 12 10 7 14 10 6 10 11 13 13 9
9 11 9 12 9 11 44 8 7 7 13 8 9 13 15 10 6
8 6 9 23 14 9 6 10 9 7 9 13 10 9 9 7 9
12 6 6 13 23 14 14 9 7 8 6 10 10 7 6 6 11
9 6 16 10 10 6 6 6 6 10 13 9 13 11 9 11 14
13 9 9 7 9 10 10 16 11 17 10 9 9 9 10 10 12