S03036-01_K16
Seqid S03036-01_K16
Sequence >S03036-01_K16.phd
CNGGAAGTGNNCNNCNCNANNNTNNNTNGATTGNCGGCCAATCGGCCGATTGATNAGTAA
ATCGGAAAGCAGTACCGNGTAAAGGCAAATTTAGATAGATAATGATAATGCACTATAATA
TATAAAAANACAACAAAAAAAAAAAAAGAAAAAAAANNNNNCTGATTTNGTNATTAGAAT
AANNCNACNCNNNNGNNCGCGNNCANCNCTCACCNCCCCCNNNNNNCNGNNNNNNNGNCC
GNTTTATTATCTCTNTGTNNCACCTAAAANGCTTGGGCGTAACNCGGGGCNNAAGGNNTT
TCNNGGGAAATGTGTANNCGCCNCACATTCCACACAACANTACGNCGCGGNNAGCATAAG
TGNAAACCCTGTGGTCCNNANTGNTGACTAAACTCACATTAATNTGCGTTGCGCTCNCCN
NNCCGNTTTCCNNNCGGGAAACCTGTTGNNGCCNGCTNTCTTATATGNNTCGCGCCAACN
NNNGGGGAGAGGGCGGTTTGNNNTATNGGCCCTTCTTCCGNTTCTCTCAGAACAGACTCC
NTCNCCCTCCNNCGCNTTNGGTGGGGGGGAGGGGGATAGNCCTNCTTCAANNGNNGNTGN
ATCCGGGNGAGGNNAAGAAATGAAGGGATTCTCTTCTTAATATTTATTTTNNNNNAAGGG
GAAAGAATANGTCGCGNACCCNNTAATACCCCCGTTTTGATGNNGNNNAAANTAAGATAA
TAATTAAGTTTTAACCCCAAAAAAACAAGAAGGAGGAGTGGGGTTGGTGAGATGAGAAAC
TTATTTAATNGAGNTGTTTCNCGGTNNAACCNCCCTNCATAANCCTNNATAANAAGCATA
ATATATAAAATTTCCCCCTAAGAAAGTGGGGGAGGAGGGGGAATGACGACTGGTGTGATG
GTCAGTTTGGGGGGGC
Quality >S03036-01_K16.phd
10 6 9 9 11 11 8 10 9 5 5 11 5 6 10 5 10
6 10 5 6 6 9 6 5 5 10 6 8 11 10 13 14 7
10 24 16 13 11 10 9 37 32 18 16 20 28 29 35 33 23
11 9 10 6 10 8 22 20 19 17 30 30 29 30 46 43 33
33 42 35 41 30 30 23 28 15 7 12 15 16 19 19 31 26
31 10 12 12 15 14 12 18 27 26 28 15 30 25 30 16 21
26 48 27 29 19 22 30 40 28 31 36 40 36 21 16 36 40
44 47 34 47 23 21 8 29 12 6 12 8 15 10 8 21 21
27 42 37 35 29 31 42 42 35 40 33 9 15 15 25 24 15
16 12 18 5 5 5 6 6 10 17 15 11 13 16 11 6 9
12 6 8 17 22 13 9 9 19 18 9 8 7 6 8 5 8
29 7 16 7 3 5 6 9 6 6 9 9 11 9 6 6 12
9 7 8 5 12 12 14 9 23 10 7 9 13 25 15 12 6
7 5 3 5 3 10 5 9 3 6 6 6 6 5 3 13 5
16 14 10 7 31 22 10 12 9 16 10 27 9 12 8 9 6
11 11 9 6 7 12 10 26 24 9 11 28 19 20 7 10 11
15 19 27 31 20 14 19 14 22 12 11 6 10 12 25 29 22
11 6 7 11 13 11 12 6 6 30 28 8 22 6 7 10 14
8 13 36 15 10 8 17 15 17 8 5 6 9 10 8 10 7
10 8 8 13 20 29 15 27 8 8 8 14 8 11 9 8 7
13 14 10 9 7 12 8 11 13 12 6 7 15 8 8 13 11
21 18 12 9 10 6 10 14 16 9 16 11 9 10 9 27 16
11 8 15 6 5 9 6 8 9 6 13 10 11 8 14 12 25
28 8 11 12 8 9 10 14 21 23 21 11 7 15 12 11 11
14 16 14 18 9 8 8 11 7 12 12 7 6 6 13 29 10
7 16 16 31 9 27 7 5 5 11 18 35 18 18 27 30 10
20 18 13 8 10 10 7 7 15 15 22 7 10 9 9 6 8
8 25 19 13 10 9 14 9 6 6 16 11 14 8 13 19 21
13 9 15 7 7 7 7 21 27 35 14 10 9 14 16 15 21
8 8 15 16 32 17 17 7 6 6 12 9 21 7 29 9 9
9 9 11 11 9 16 16 12 18 8 7 27 35 25 15 15 8
11 14 8 18 17 10 14 10 19 22 20 21 12 6 12 11 7
15 16 10 22 9 13 6 6 10 12 11 6 9 18 7 15 11
9 16 27 19 19 26 15 12 12 22 28 22 17 15 15 11 15
10 7 9 9 15 7 12 10 9 8 9 11 7 6 9 7 7
10 6 11 9 6 9 15 12 15 19 25 11 7 9 9 9 12
7 6 9 8 23 18 18 21 8 13 18 21 29 17 15 9 10
13 11 14 16 14 20 15 20 10 16 22 22 12 9 9 10 12
11 18 20 30 7 5 6 7 7 8 12 13 14 14 16 10 11
16 10 27 15 18 11 7 15 10 12 12 13 13 7 13 14 14
8 7 7 11 19 14 12 8 12 13 9 18 12 12 9 9 9
11 11 10 10 10 7 6 13 6 6 7 9 10 14 7 13 13
10 10 11 14 11 27 10 11 10 12 8 14 13 9 16 11 14
11 10 11 11 26 12 11 32 17 16 18 46 16 14 15 18 15
16 12 11 13 11 12 16 14 13 14 12 19 19 11 8 11 13
12 14 9 14 9 17 13 11 11 15 10 8 13 14 19 32 13
16 27 9 15 24 19 11 6 8 11 9 7 12 19 17 13 21
8 6 9 16 19 9 6 6 9 18 12 11 6 9 11 9 8
7 11 11 15 17 14 6 9 8 14 7 6 14 19 27 14 7
10 13 17 14 14 14 13 14 18 17 16 17 13 14 28 16 17
18 13 12 13 15 18 32 15 15 12 8 11 15 18 13 13 13
16 14 19 14 13 14 19 20 19 20 23 18 14 12 13 15 19
16 16 18 20 17 8 9 14 13 20 17 19 13 12 11 14 16
16 18 16 16 15 14 19 16 27 27 19 15 15 13 15