S03036-01_K23
Seqid S03036-01_K23
Sequence >S03036-01_K23.phd
NNNNNNNNNNNNNNTNAANNNTCNANAANNNNGTGATTGNGNGGNGNGTCGGCCGAATTT
GACGATATTAAAATGTGGAAGGCCGTGATGAATGCTTGGAATGGAACCGAGAGTCAAAGT
AAGAATGTTTCAAATATTCAATCTTACAGTTTTGAAGACATGAAAAGAATCGTTGGAAAG
CATGATCCTAATGTGGTTTTGGTAGATGTTAGAGAACCATCTGAATACTCGATTGTTCAT
ATTCCTGCTTCCATCAATGTGCCATATAGATCGCATCCCGACGCGTTTGCCTTAGATTTT
TTAGAATTTGAGAAACAGATTGGCATCCCAAAACCTGACAGTGCCAAGGAGCTAATATTT
TATTGTGCTTCTGGCAAACGCGGGGGAGAAGCTCAAAAAGTCGCCTCCTCACATGGATAT
TCAAACACCTCACTATATCCTGGCTCTATGAATGATTGGGTTTCNNNTGGCCGNCNTAGA
CTGAACNNNTANCCTTGTNNTCTCTANGTATGTTTGNTGTGTAACTAAGNAAGNNAGTAA
CGGATTATGNCATTNNTTNNGGGNGANNGAAAAAGNAAAANCCAANTAGAANNNGNNGAN
GNNGGGTGGAGGGGGGGNAGGGGANTTTTTGTTTTAAANATANAAANANNAAAACAAAAN
AAANNNAANTTNTNGGGGGGTGAGGGGAAGGNGGGAAGNGTGCTCNGTNTCNNNATNGGG
GNCANGAGAGGGNGGGGGAGGGATGANNNNGTTTNTTATNNTTTATTATANNAGGAGGTA
TGCNNANTTCAGACCACGGGCAAGGNGGGTTNAGCCNCGNAANANNGTCCTACCTGNCGG
NACGGGGTNTNGGAGTGGGNCGNN
Quality >S03036-01_K23.phd
3 3 3 4 4 6 2 6 2 7 5 5 4 7 16 6 10
8 7 6 5 8 12 5 8 5 9 9 3 5 5 6 10 9
12 9 10 11 12 6 12 6 23 24 7 9 7 9 15 16 29
25 15 20 20 17 9 12 13 15 9 15 14 26 35 20 26 26
25 18 19 21 24 23 41 32 40 33 19 19 30 21 9 32 30
28 30 20 26 44 29 28 34 32 28 28 26 26 23 25 31 29
46 30 24 29 33 25 30 31 30 30 41 42 41 36 37 50 50
46 46 42 46 43 35 42 43 43 53 31 32 28 26 40 46 35
44 47 42 31 38 49 49 49 47 46 52 38 52 52 52 49 49
51 43 42 49 42 36 49 57 51 50 49 49 49 49 50 46 42
49 43 41 41 38 46 39 40 46 40 46 49 49 50 42 46 49
54 50 45 53 53 53 51 53 53 49 57 53 53 51 51 40 42
41 43 38 49 54 42 50 54 54 46 49 47 38 50 32 49 46
49 54 43 43 42 42 38 35 39 31 28 26 27 35 26 29 39
35 42 42 43 42 46 49 49 51 37 43 50 50 50 50 54 54
43 46 46 43 46 51 50 50 49 46 49 54 54 54 57 50 50
50 51 49 46 46 51 49 49 57 50 54 57 54 50 49 46 51
42 49 49 49 49 42 45 44 57 51 51 47 50 44 54 54 50
44 46 46 49 49 43 53 47 53 42 57 43 45 38 54 50 49
49 54 54 54 54 50 42 42 46 43 49 50 39 42 29 42 39
30 36 42 42 42 27 39 39 46 44 35 32 26 28 37 35 39
36 36 35 35 42 28 43 49 43 57 43 50 49 54 59 50 44
35 36 32 38 35 20 35 22 22 22 22 22 44 22 44 38 42
47 60 47 60 37 41 41 30 35 42 40 21 24 60 47 47 60
42 42 44 35 24 35 42 45 33 44 20 30 35 24 16 31 35
39 21 33 33 42 24 44 33 42 42 42 35 60 33 42 42 38
16 11 35 35 27 35 27 35 33 43 39 42 35 12 22 21 15
15 22 23 17 9 7 7 6 13 17 9 9 9 10 7 9 7
8 11 9 9 16 11 9 8 9 8 7 6 6 9 14 7 9
19 16 22 20 23 7 5 9 9 11 9 11 9 6 9 12 9
14 9 9 9 10 9 6 11 21 9 14 13 16 9 8 12 9
9 9 7 14 24 9 6 7 10 19 12 19 13 19 22 12 9
12 16 18 20 22 6 14 19 23 16 7 6 9 11 7 6 15
11 12 7 9 11 6 6 11 22 17 23 24 9 8 7 8 36
24 13 7 11 10 19 11 6 9 19 11 10 11 6 6 6 9
6 7 8 9 6 9 7 6 23 35 9 8 12 10 10 13 33
28 41 23 23 12 6 8 9 17 11 22 8 6 11 13 10 12
11 10 24 20 16 13 10 9 11 6 10 10 16 6 17 14 9
6 11 6 6 14 19 9 9 9 10 14 10 14 6 9 9 9
6 6 6 10 9 6 9 10 6 11 6 9 19 11 9 14 13
15 14 11 10 11 10 14 26 11 11 10 7 9 23 14 11 14
9 6 9 11 11 10 14 14 6 9 8 6 10 11 6 6 6
10 8 6 9 13 11 11 6 11 11 6 10 10 23 10 15 14
11 6 10 10 40 38 10 8 8 12 11 11 9 11 11 5 6
7 5 10 18 17 11 7 11 12 8 10 6 6 10 10 19 11
8 10 8 9 9 6 6 9 9 8 14 10 19 10 11 11 8
9 6 7 9 6 10 10 11 14 14 10 10 11 8 11 10 11
10 10 11 11 11 30 7 19 12 16 10 8 7 11 23 10 9
6 8 9 6 14 9 6 9 6 6 8 10 11 10 9 10 9
12 11 11 6 10 9 37 6 9 9 14 17 11 10 8 5 9
5 11 23 8 16 8 13 19 8 5 11 9 6 6