S03036-01_L02
Seqid S03036-01_L02
Sequence >S03036-01_L02.phd
GNNNNNNTNNNTNTNNNGCCCNNNAAAANNGNNGTGGAGGCGGGTCGGCTATTTGTNAGA
GGGATACTGTCATAGCTCTTTCATTGGCCTTNTTAGATTGNGNCNNTCTTTCCCATTGAC
GTTGTTACTCCCTGTCTTTTTTCGTTTTTAACTGATTTCTCATATATTCCCAAACAGGCA
TATATACTCGACGTCAAGAAAGAAAAGAAAAGAAAACCCTCATAAAAAATATAATCGAGA
AGTTTTTTTCCTCATCGCGAACCATTAGTATAACANATTGNTCGTTCAGCTCTCATAACT
ATCGCAAGAACAGTAACANNATAAATAAAAAAAACACGNACATATAATAATGTNGGCTCG
TACTGCTGCTATTCGTTCTCTATCGAGAACTCTAATTAACTCTACCAAGGCCGCNAGACC
TGCCGCTGCTGCTTTGGCTTCCACCAGAAGATNGGCTCCNNCCAAGGGNCAACCCNAAGG
AAGNTTCCTTAANNTTANAAGAANGANTTTANNTGTTTTATTAAAAGGGNNAAATTGAAG
GGACTGGGNGACGTGAGTTNAGGTGNGAATGGATAAGAAANAANCGAAAAGGAGGGGCGG
GTTGGCGGGGGAGGGNAGANGGTGGNGAGGGAAANCTNTAAAGATATAGTANGANTGGAT
AAAAAAGAAATNCGAAGGGAGGACGGTTGGGTTATAAGATTATCNAGAAAGGAAAGGAGA
CGTANGTTAGAAAAGCACTCACCCGGAACGAGGAGAAGGGAGAGCGGTGCGATNTGCTCG
CCTATTTATGATTTTAAAAAGTGGGAGAGAGACAAGGGGGTCAAGGGGGGCAAGAAANNG
GGTGGGTTGCCGTAAANNGANAGACTCGGAATCGTGAAAATTTTCNANTGGTCANACGTN
NNNTNANTN
Quality >S03036-01_L02.phd
8 7 6 3 3 5 6 10 5 5 7 11 5 9 5 6 6
9 8 11 9 6 6 7 8 8 10 9 6 7 9 6 6 11
9 19 9 9 9 12 10 9 11 10 9 21 21 15 11 9 17
12 18 27 14 9 7 12 13 19 14 13 9 11 18 21 19 21
33 11 13 23 13 11 16 12 12 19 14 11 9 9 8 18 23
33 9 9 16 13 11 6 18 13 9 13 20 11 13 38 6 11
7 11 6 6 10 10 11 11 9 10 13 19 14 13 18 26 23
37 23 46 53 53 53 21 19 35 35 27 30 33 42 50 32 37
40 40 53 53 46 20 30 17 14 40 22 14 19 33 40 37 53
53 33 23 40 28 24 19 32 12 28 24 26 14 37 50 40 32
33 24 20 18 28 14 38 45 47 19 32 53 45 45 60 47 53
35 44 25 44 53 53 45 53 10 14 17 19 14 23 33 37 24
23 34 41 41 18 10 9 16 32 18 18 18 35 37 40 31 24
12 13 14 12 8 8 11 14 23 19 13 13 12 18 24 18 60
45 53 40 45 53 53 53 53 60 57 47 45 47 38 21 20 42
53 42 38 42 53 53 37 28 19 34 28 35 53 33 39 42 42
27 27 16 5 19 19 17 18 7 10 14 25 24 19 25 33 35
27 37 45 45 45 23 24 9 19 39 42 37 32 35 32 10 19
9 27 26 38 53 27 33 19 19 14 18 14 6 7 18 11 16
16 37 41 23 22 22 24 16 28 32 21 23 19 47 9 6 9
33 19 28 34 24 19 27 11 19 26 42 57 18 6 8 9 27
37 40 53 40 46 40 39 53 44 53 35 40 14 17 26 26 33
19 21 19 35 41 31 35 50 53 42 28 28 33 42 32 32 40
26 21 27 26 33 20 9 12 11 46 35 40 30 37 23 37 32
42 30 23 35 14 16 5 8 13 26 30 42 31 37 27 30 27
37 53 42 27 28 37 34 35 38 28 50 19 15 20 20 11 10
11 9 14 14 11 17 22 20 9 11 6 14 13 16 9 11 12
6 6 19 28 10 9 9 16 10 6 14 22 26 31 34 18 6
8 9 15 11 25 22 9 6 11 25 10 15 22 11 10 11 6
6 12 11 12 7 18 9 18 16 14 7 10 15 7 9 20 9
11 6 6 8 11 9 25 11 16 9 8 8 32 27 9 16 10
13 15 7 6 11 11 10 14 11 9 19 17 9 9 15 14 10
9 12 11 9 6 11 21 11 13 13 13 13 15 9 9 7 13
13 11 10 8 7 8 11 10 11 10 18 11 9 14 11 8 15
13 10 7 12 12 6 10 10 8 11 14 12 28 19 10 25 9
29 14 9 8 10 9 9 11 10 11 11 14 27 27 14 22 16
20 12 14 7 12 9 9 7 14 12 9 12 18 6 10 12 13
14 12 8 9 9 6 10 15 6 14 11 14 14 13 16 16 14
11 11 11 14 12 7 10 9 7 10 10 11 13 14 11 13 17
24 14 10 11 11 17 26 10 6 9 9 11 17 15 14 20 12
14 11 15 19 17 9 9 11 10 16 16 12 14 27 18 10 9
8 11 11 11 13 11 13 7 11 22 24 9 11 10 10 9 17
17 13 11 12 15 13 11 11 14 8 7 11 14 10 9 11 15
14 12 11 16 27 22 15 10 11 17 12 17 14 13 20 24 20
20 19 13 14 9 9 11 9 12 9 9 9 9 11 12 8 11
14 11 9 19 8 9 15 10 7 15 14 11 16 17 13 11 11
18 16 21 9 10 10 12 11 14 12 13 16 9 8 10 18 22
14 10 11 11 16 15 14 13 10 14 11 9 10 11 11 11 13
9 9 9 15 8 11 9 8 9 9 12 9 10 11 9 10 10
10 10 9 9 6 6 14 12 13 10 10 9 16 16 9 10 14
13 15 13 16 9 11 6 7 10 11 7 10 9 13 10 11 15
11 13 11 9 10 12 12 10 10 12 11 23 15 11 9 10 11
9 6 9 6 8 8 9 10 10 10 7 11 8 14 9 6 6
7 6 8 7 9 6 9 6