S03036-01_L05
Seqid S03036-01_L05
Sequence >S03036-01_L05.phd
NNNNNNNNNNNNNNNNNNGNNCTANNNANAGGGCGATTGGCGGCCAAATCGGCCGATTGT
ATGACTTCCACTCGCTTAAAAATAACTAATAACAATAATCCCTAAAATGAAACTCTCTTC
CGCTTTGGTTCTATCTGCTGTCGCCGCTACTGCTCTTGCTGAGAGTATCACCACCACCAT
CACTGCCACTAAGAACGGTCACGTCTACACTAAGACTGTCACCCAAGATGCTACTTTTGT
CTAGACTGGTGAAGGTAGCAGCAACACCTGGTCTCCAAGTAGTACTTCTACCAGCTCGGA
AGCTGCTACCTCTTCTGCTTCAACCACTGCAACCACCACTGCTGAAACTTCTTCTTCTTC
TGCTACATCCTCTAGCACCGCTGAATTATCTAGTTACACCGGTGCTGCTGATGCCATCAC
CGCTGGTACTGGTTTGATGGGTGCTGCCCTTGCTGCCGTCATGTTANTGTAAATGATGTG
TGAATAATCATGCAGGATATCCCGATTTTTATGAAGCACCTTGCGGCTTGGCCTTTTTTC
GAAGTTGTGTTAGAATAAAAAAATTTTTAATAACACACATTAAGTATGTATGTATATATA
CTGTTTCCAGTTTCCTTGGTCTTCCTTTTATGGTTTGAACCGTTTAAAATATCTAATTAA
AATAAATATAACCCGAAATCATACANAAAAGTAGCCCCCCCCCCCACCCACGCACGGCGG
GGGAGAGGGGGAGGAGAGGGTNCGGTCCTTTAGGGGCAATTGAAAATNTTTTAAAANTGG
CAACAGAAACAGGCAGGGCAGNAANCAGGCNGAAAGNGTTTTATANTGNNACATTCCTCN
NAATTAGAAATTCAGGNGAGAGAGGGGAGAGGAGAGGAGGAAAGGGGAATCCGCAGNNGG
AAAAAAAAC
Quality >S03036-01_L05.phd
5 3 2 4 3 2 2 3 2 3 4 3 3 5 6 3 7
7 10 7 5 8 8 9 7 5 3 8 7 8 8 21 31 9
25 31 13 29 41 14 15 31 20 16 22 11 19 30 47 37 41
25 35 29 36 15 12 22 44 34 21 21 40 31 17 51 52 50
19 17 41 50 49 41 49 49 35 35 45 42 49 40 34 50 50
42 31 26 33 46 52 51 42 31 50 52 52 49 49 49 51 51
46 46 43 35 39 35 46 30 21 21 32 46 40 40 49 49 50
50 49 43 38 46 46 49 42 52 57 49 43 53 44 53 49 53
53 44 43 51 57 49 47 57 53 49 57 45 50 45 57 57 51
57 57 57 57 57 47 63 52 52 34 58 49 51 49 50 63 60
50 63 42 63 63 47 57 49 47 58 49 54 52 51 50 63 58
44 44 45 47 63 49 63 63 47 60 63 47 49 42 47 50 58
54 50 60 60 25 50 50 57 57 57 52 44 60 60 47 47 47
57 63 63 47 58 57 52 44 57 42 52 60 52 57 60 60 46
52 34 57 52 47 60 52 42 52 60 63 42 60 52 63 46 63
34 35 44 60 44 35 59 34 57 47 30 52 63 46 60 63 42
52 44 44 60 26 63 47 52 39 44 60 47 44 42 63 40 42
46 46 63 35 60 47 47 44 44 54 44 58 39 42 42 44 35
44 33 42 45 47 44 47 63 39 39 47 33 44 63 28 27 63
42 58 35 42 47 47 44 33 63 42 63 33 47 63 35 44 60
44 35 44 44 44 59 59 44 35 57 39 27 57 44 31 59 35
34 59 35 39 50 30 50 30 35 35 50 44 54 46 44 47 42
34 50 42 35 57 44 42 59 44 59 59 44 59 34 34 42 42
44 42 44 59 44 42 27 42 59 44 57 44 42 37 39 44 34
42 50 50 31 42 24 57 31 43 39 24 42 57 33 33 42 39
57 21 42 32 31 43 53 24 51 53 35 32 23 35 57 57 30
43 28 35 36 21 57 57 29 51 35 30 38 33 27 57 32 35
35 27 32 46 16 49 12 7 16 35 16 22 54 54 32 35 32
23 38 30 38 41 35 32 57 30 28 59 27 30 28 33 41 19
31 28 49 28 16 35 35 13 40 31 10 20 9 15 43 49 49
33 33 22 27 52 27 35 28 25 49 28 52 27 23 30 52 27
43 49 38 52 22 49 18 49 49 46 37 36 30 16 35 36 13
16 26 29 21 41 28 38 27 11 31 41 41 19 33 37 43 49
52 51 22 52 43 35 28 26 9 27 16 35 35 20 32 21 18
30 41 41 21 20 17 20 27 21 27 20 17 18 27 15 18 13
27 18 29 30 40 25 17 21 11 21 26 17 12 16 11 10 15
11 17 11 11 21 21 27 10 21 12 28 15 25 17 21 16 14
10 9 9 29 14 19 16 12 12 16 18 10 11 10 18 12 12
16 35 17 30 11 31 8 21 11 10 11 14 8 15 27 23 15
32 44 44 14 17 14 12 14 16 24 10 14 32 30 34 15 20
17 10 9 9 8 6 18 22 17 36 10 16 16 11 15 14 17
14 25 34 25 25 23 14 18 17 14 14 14 18 14 11 14 10
15 11 14 16 20 14 15 14 14 12 25 14 15 11 29 19 14
10 10 10 10 10 10 11 18 11 9 6 10 11 18 11 19 10
11 15 10 11 14 23 18 13 10 15 10 10 10 11 13 11 13
10 23 7 14 13 15 9 14 11 11 10 7 8 14 12 13 10
12 15 14 11 14 25 18 11 16 13 11 9 10 10 15 9 9
10 11 6 9 18 6 15 16 19 18 12 7 9 16 15 11 11
7 15 10 11 10 12 10 14 11 6 8 10 7 7 20 14 10
9 9 12 9 10 8 6 6 9 11 9 8 9 10 11 10 14
12 9 18 9 10 11 6 11 11 13 17 30 18 19 19 19 14
20 18 10 18 46 11 33 14 13 15 11 17 18 14 14 14 14
13 11 14 17 14 10 9 10 10 10 11 8 6 7 11 11 34
13 19 14 22 15 12 11 10