S03036-01_L06
Seqid S03036-01_L06
Sequence >S03036-01_L06.phd
NNNNNNNNNNNNNTTTNNAGGGCNCNNNNANANGGGCGATTGGCGGCCAAATCGGCCGAA
TTGGAGAATCGTCCCTGTAAAAAAAATTGAAACGGAACAAGAAAAATAACTGACGTTCCT
TTCTTTAAACGTTAGGGTGTACTATAATATATTCCATAAGAGATACCCGTTTCTATAAAT
GCAAAGCTCAACAAGTACTGATCAACATGTGCTACATCACATGGACCCTCATCGGTTTAC
GTCCCAAATACCAACTGCAACATCGTCACAATTGAGGAGAAGAAACAGCACGAATCAAGG
TCTAACCGACATGATCAATAAGAGTATTGCCAGGAATACAATAAGCGGGACTGGCATTCC
CACAGGAGGCATAAATAAAAATAAGAGGACAAGAAGCACGGTTGCAGGAGGTACAAATGG
TACAGCATTGGCTCTAAATGACAAATCCAACAGTAGAAACAGCGTCAGCAGATTATCAAT
AAATCAACTTGGCAGCCTGCAGCAACATCTGAGCAATAGAGATCCAAGGCCACTAAGAGA
CAAAAACTTCCAAAGCGCTATTCAAGAGGAGATTTATGACTATTTGAAAAAAAATAAATT
TTGATATTGAAACAAATCATCCCATTTCCATTAAAATTTTTGGAAACAACCCCCTTCAAA
AGGGGTTAATATCAATTTTAAAGAGGGTATCATTAAAACTCTAGCCTGTTAGGGTTTTAA
TANAATATTAAAAAATGAAAAACAAACCACAAGAACAAAAAGAGGGGGGGGAGAAGAGGA
GGATAAGTTATTNATATAACATAGACGGTACAGANNGGCGGGGGAGGGGGGAAATACTTG
TAGNCAGTATAANATAAATGAACACAACNACATTAACTAAACCGGCGCGGGCGAGGGGGG
GGNGCGTGGNGAGNGNNGTTNAATAATATCNAG
Quality >S03036-01_L06.phd
7 4 3 5 3 3 2 2 3 3 4 3 7 15 13 8 7
5 10 10 9 9 9 6 9 3 5 3 5 8 7 8 6 8
14 20 10 24 41 25 29 31 15 19 21 26 17 18 12 16 25
39 37 35 20 34 35 28 30 16 32 34 26 15 23 26 30 21
16 35 26 36 41 41 33 35 44 31 40 46 40 46 37 43 43
40 33 43 43 27 24 26 33 42 43 43 30 42 30 31 42 38
25 35 36 44 44 35 35 35 39 42 34 28 35 36 31 44 42
39 44 44 47 60 60 44 42 42 42 50 60 54 50 47 44 44
35 47 54 54 54 44 44 50 50 54 60 50 60 59 54 63 58
58 44 44 50 50 50 49 63 58 45 44 50 50 54 53 51 54
50 54 54 44 50 50 54 54 50 57 57 51 50 51 51 57 52
57 57 54 59 57 57 57 57 57 54 53 53 53 53 57 57 57
57 57 57 53 57 57 53 49 50 50 54 54 54 54 54 50 44
49 51 50 45 57 59 57 51 57 54 59 54 50 50 43 43 42
32 30 42 50 39 42 39 35 32 38 44 42 50 44 50 49 53
53 57 57 50 50 54 54 59 54 42 50 54 54 54 50 50 49
53 53 57 44 57 57 44 57 57 43 57 53 50 50 42 57 54
50 50 54 51 51 50 54 38 54 54 57 59 57 52 54 57 54
54 54 57 42 54 54 54 50 40 49 50 50 54 50 49 49 53
54 54 50 41 51 57 50 51 43 50 53 53 45 42 59 54 42
54 54 50 49 50 54 54 49 46 34 38 50 46 45 43 35 42
49 49 50 54 35 49 39 43 53 35 21 50 33 49 50 54 54
54 54 54 54 54 54 54 46 49 49 49 53 38 50 44 39 42
49 46 45 43 37 49 43 54 54 54 54 57 52 54 54 44 53
51 26 51 54 51 50 49 50 51 54 59 59 44 54 54 42 50
50 54 54 59 54 50 39 47 49 44 36 54 54 54 57 44 43
39 46 49 54 52 54 29 54 54 39 39 50 60 44 60 54 60
60 47 49 49 54 54 50 44 44 47 44 50 54 33 60 50 60
60 44 47 50 44 47 47 44 47 28 47 60 44 54 54 50 42
42 50 44 47 47 57 25 44 47 44 44 46 60 47 60 52 60
57 52 33 47 44 60 57 60 35 44 34 32 31 32 42 30 47
39 52 19 47 41 44 46 29 60 42 32 29 33 46 46 46 46
46 46 46 44 60 46 47 47 59 52 46 46 60 46 52 29 47
46 35 26 46 47 52 35 60 46 12 26 26 44 41 25 27 23
25 18 26 31 31 47 41 31 32 32 46 53 32 10 26 12 14
11 46 53 18 23 26 20 14 46 24 20 32 24 19 19 26 19
16 19 13 17 18 22 15 18 18 22 33 17 40 32 27 20 18
14 12 9 10 13 24 32 15 32 18 11 8 10 14 17 19 18
11 16 32 17 16 19 11 11 11 19 13 10 19 26 24 22 30
21 34 11 16 10 11 19 12 12 12 32 18 19 26 24 17 17
20 18 17 18 17 28 11 9 18 10 10 10 13 15 13 18 14
22 13 14 14 12 16 11 9 10 13 13 14 17 10 10 10 11
9 12 11 10 12 19 13 19 6 12 11 9 26 15 28 19 14
13 14 28 12 15 14 26 11 27 14 11 11 11 19 16 13 11
13 20 16 9 9 13 13 16 14 14 17 13 12 14 13 11 10
16 23 20 20 13 14 17 16 9 14 18 14 13 10 9 16 11
11 11 17 22 13 11 28 17 11 11 7 13 11 15 13 18 16
11 12 18 14 11 10 10 11 14 14 11 10 10 12 12 6 7
12 18 9 18 17 18 19 15 11 20 27 32 22 16 11 18 18
19 11 12 12 13 11 11 15 13 10 6 9 10 11 16 15 13
16 13 6 13 9 11 10 17 12 11 9 17 22 18 13 11 16
16 7 11 11 11 9 15 11 19 12 14 9 14 17 13 14 14
15 13 15 13 16 11 9 13 11 11 11 13 17 9 9 8 20
11 7 10 11 9 9 24 9 7 9 11 14 6 8 6 6 21
9 9 6 9 9 8 15 12 12 14 19 11 7 14 16