S03036-01_L07
Seqid S03036-01_L07
Sequence >S03036-01_L07.phd
GNNNNNNNNNNTNNNNNNNNNNCNNNNNGGGCGATTGGCGGCCAATCGGCCGAATTGAGA
TCAAGAAAATATCAAATCCAGGATCACACGACAACTGAACGATTACATCGGCCTATAATA
CGTTGCCATGAGTTTAAAGGAGGAACAAGTGTCCATTAAGCAGGACCCGGAACAAGAAGA
GCGTCAGCATGATCAATTCAATGATGTTCAGATCAAACAAGAGTCGCAGGATCATGATGG
AGTGGACTCGCAGTACACGAACGGTACGCACAATGACGACAGCGAGAGATTTGAGGCAGC
TGAATCCGATGTAAAGGTGGAACCCGGCCTCGGTATGGGCATCACCTCCTCTCAGAGCGA
AAAGGGTCAAGTTCTGCCTGACCAACCGGAGATTAAGTTCATTCGTCGTCAAATCAATGG
TTATGTAGGGTTTGCTAATTTGCCCAAGCAATGGCACAGAAGGTCCATAAAGAACGGATT
CAGTTTCAATCTCCTATGTGTCGGCCCTGATGGTATTGGTAAAACAACTTTAATGAAAAC
TTTATTTAATAATGATGATATTGAGGCCAATTTNGTGNAAGANTTACNAAGANGNANTTT
TNAATGATTNGNNNNNANAGGAGGGGCAGTGCGAGGGTNNCGAAATNTAAACANAAGAAC
AAANGCACAAAGGCCAAAANTNNATCATAGGGAGAGGGGAATAGGANNAAATAGTATAAA
AATGGAAATGACGCGNTGCAAAANCCGNNGTANAGGAATGTATGAANAAGGGNNAAANNG
ATGACCCAGAAACAGAGNGGATTANGGAGCNTGTGGCAATACTANAGACNNTTNTTAGAN
ATCCNNCNGNTNGNAANCTNTTGTGTGGACGCGAAGNTAACNAAAANGGTCCAGGCGNAA
NAATGNTCCTGCNTNGGA
Quality >S03036-01_L07.phd
12 5 4 2 5 6 4 4 5 5 6 16 6 6 7 7 7
4 5 3 7 7 9 5 5 3 3 5 15 32 29 13 29 31
17 30 26 12 10 34 24 20 9 9 8 32 35 44 25 40 36
45 28 16 31 41 35 30 31 17 16 28 26 21 37 34 31 36
25 27 35 28 34 37 43 49 51 50 32 16 41 49 22 26 50
16 49 30 50 46 50 49 34 42 49 39 33 29 37 43 50 43
42 47 41 52 21 49 49 42 46 46 46 43 47 52 50 49 49
52 50 54 57 57 51 54 50 31 49 42 44 47 49 53 50 40
54 50 54 49 50 42 49 50 38 42 38 54 51 57 57 54 49
53 43 49 42 57 57 57 54 54 51 46 30 32 54 57 49 49
42 49 42 34 54 54 42 49 49 57 54 52 59 54 54 50 59
59 59 54 43 42 43 51 35 53 49 57 50 34 50 49 49 45
38 51 46 52 50 39 49 50 39 54 35 51 51 50 34 57 59
52 42 54 59 59 42 54 29 57 44 27 46 46 43 54 50 39
50 57 50 42 59 54 51 45 21 50 50 44 49 49 39 52 34
43 30 44 36 50 57 42 34 54 42 54 44 34 54 31 42 44
57 50 50 41 38 39 54 43 20 54 59 43 54 34 54 44 44
19 53 53 50 59 44 50 35 31 42 52 54 54 45 45 38 42
45 44 49 25 50 39 34 50 50 42 50 25 50 57 38 50 31
57 53 49 57 44 57 42 54 27 51 40 46 35 49 45 42 39
35 42 54 34 38 53 42 49 53 42 54 43 43 34 34 54 22
42 50 35 43 18 21 39 53 45 22 54 37 43 45 39 53 49
49 42 33 53 49 49 43 27 49 30 57 42 51 54 57 42 21
31 19 51 35 57 46 49 53 40 35 42 57 59 43 54 54 54
54 49 28 57 54 43 46 32 50 46 46 42 35 51 35 30 50
35 35 32 53 53 21 53 53 42 31 46 30 49 43 57 52 42
35 51 46 26 51 35 54 23 57 35 40 34 31 42 36 31 30
46 41 13 30 15 26 43 26 35 26 51 47 32 40 45 26 35
54 42 15 45 28 18 35 35 42 41 26 13 46 35 42 32 30
28 24 32 27 46 35 37 35 35 29 42 15 34 37 29 32 34
13 20 30 33 29 28 42 32 50 32 26 42 41 42 27 10 19
13 15 37 18 27 33 28 32 16 43 22 27 29 26 19 31 39
26 40 39 27 32 32 26 23 28 39 24 13 29 32 21 36 37
30 32 21 14 38 12 29 11 8 9 19 19 7 10 24 30 5
8 8 11 17 7 17 10 10 14 6 16 13 10 9 6 14 6
10 6 10 19 17 9 7 9 16 9 18 26 9 8 6 9 7
6 7 7 7 8 6 9 10 14 27 8 11 9 8 18 12 9
11 8 13 11 25 9 14 11 13 6 6 9 11 35 8 9 8
6 11 10 10 9 11 11 6 14 17 17 47 46 32 32 30 13
7 14 9 11 14 10 9 8 11 18 9 11 14 12 13 15 6
9 6 6 9 19 11 9 10 25 13 23 9 14 9 11 8 10
11 11 10 12 8 11 8 12 11 6 7 9 8 9 11 11 23
11 8 11 14 18 27 22 12 9 9 8 14 10 8 10 8 13
15 9 9 11 6 9 10 9 9 14 9 8 6 10 9 9 6
6 11 8 9 6 9 11 14 9 10 9 9 11 9 28 16 8
9 6 18 10 10 9 10 7 6 10 9 9 6 6 9 9 10
11 8 9 10 9 12 12 10 10 14 10 10 10 9 14 6 10
8 9 11 9 9 6 9 8 14 9 9 7 12 9 11 12 10
8 9 11 10 19 8 11 9 6 9 9 8 8 6 6 13 11
6 9 8 10 11 11 6 9 9 11 11 6 6 8 7 9 6
8 6 8 6 9 10 6 11 8 6 10 9 10 11 11 11 9
9 14 10 9 8 14 10 8 9 6 11 8 9 10 7 10 11
10 8 6 8 9 9 18 9 13 14 9 11 9 6 9 9 7
9 11 11 10 6 11 16 11 9 11 9 6 11 6 10 8 9