S03036-01_L08
Seqid S03036-01_L08
Sequence >S03036-01_L08.phd
NNNNNNNNNNNNNNNNAGGGNNNNNNNATAGGGNGATTGGCGGCCAAATCGGCCGAATTG
AAGGATAACAAACATCTTCTTTCGTTCGCTTCAAAATAACTACAAATTAAAAATGCAATT
CTCTACCGTCGCTTCTATCGCTGCTATTGCCGCTGTTGCCTCCGCCGCTTCTAACATTAC
CACTGCTACTGTCACAGAAGAATCTACCACTTTGGTCACTATCACTTCCTGTGAGGACCA
CGTTTGTTCTGAAACAGTTTCCCCAGCTTTGGTTTCCACTGCTACCGTCACCGTAAATGA
CGTTATCACTCAATACACCACCTGGTGTCCATTGCCAACCACTGAAGCACCAAAGAATAC
CACTTCTCCAGCTCCAACTGAAAAGCCAACCGAAAAGCCAACTGAAAAGCCAACTGAAAA
GCCAACCCAACAAGGTTCTAGCACTCAAACTGTTACCTCCTACACTGGTGCCGCTGTTAA
GGCTTTGCCAGCTGCCGGTGCTTTGTTGGCTGGTGCTGCCGCTTTATTGTTGTAATTTAC
TCAACCTTTTCTTTAATATATTTTTAGNNAAATGGTTAAGTACTTTTCCGTCAATACAGC
TTCCACAAAATTCTTTTATTTCNGTTAATAANATATTCTGGTAATTTCTTATTCTAATTA
TAGGAGGCAACACTCCATAACTAANTGTTTANTATATNATANTAGNATAAAGTAAANNCT
CNNAAAACANCAGCAAGCACGGTGNGACGGTATAAGTNAGAGGAANNTAAAAAAANATAT
ANAATNTGTGGNCANNGGANGTNAAANNATGTANATGAAAAGGNNACAAAGAGANTAGCA
TANGNGNAANAACANGCNNCAAGGAGGNGAGTNGNNGAGGACNAATGGGCTGNGATCATG
TGGGTANAGGANNAAN
Quality >S03036-01_L08.phd
5 3 2 2 2 4 3 3 5 4 3 3 5 5 5 6 8
10 8 9 5 5 6 5 5 7 7 14 9 13 12 23 12 7
20 25 18 26 30 13 11 32 25 15 15 13 11 20 30 30 33
28 30 28 31 29 12 23 30 29 14 15 23 31 15 10 29 28
32 28 30 41 30 31 42 35 33 32 35 31 43 35 36 35 35
35 42 30 42 49 50 42 39 42 49 42 38 35 37 46 34 34
42 31 39 35 35 32 35 27 35 27 26 21 38 34 35 36 50
54 50 54 54 44 54 50 60 49 49 47 60 54 49 58 63 45
50 54 54 49 47 50 60 50 41 49 50 54 50 50 49 50 54
54 50 60 54 50 52 54 57 58 60 60 58 58 60 50 50 50
57 45 45 60 50 50 49 51 49 54 50 54 57 43 34 53 45
43 51 59 57 54 54 59 57 50 52 57 57 57 57 50 50 57
57 49 51 50 50 50 49 54 50 51 49 50 54 54 45 54 54
50 45 46 49 54 50 50 54 54 54 54 57 44 50 50 44 30
32 29 29 38 38 38 38 49 49 49 50 57 53 57 57 51 54
51 59 54 53 51 51 51 54 51 54 54 59 57 53 51 57 57
50 57 54 51 51 49 57 57 57 51 50 51 57 57 57 59 57
54 50 57 57 51 54 54 51 51 57 57 44 57 51 57 54 54
54 54 51 54 54 51 54 54 57 57 54 50 53 49 51 57 57
57 53 51 51 49 51 49 50 57 57 57 54 50 42 50 49 50
50 54 50 49 44 50 50 54 43 42 50 39 50 54 54 54 54
50 44 42 44 46 49 49 54 54 54 54 50 50 54 53 53 50
45 39 53 57 57 57 58 60 49 54 54 47 47 42 49 49 60
60 50 49 49 60 47 44 50 50 58 49 58 58 63 60 63 46
50 47 54 54 60 54 60 57 44 44 49 50 60 54 50 47 60
49 49 49 60 50 54 60 60 50 58 49 63 47 49 54 60 50
49 50 60 50 47 47 50 60 60 60 47 47 49 50 49 49 60
60 49 49 47 47 47 47 50 44 47 49 47 43 37 44 50 49
47 49 47 42 30 37 19 47 47 60 47 28 47 40 40 47 60
57 29 60 42 35 34 43 60 47 35 35 52 22 57 57 40 28
39 52 57 47 60 52 52 60 57 52 46 46 52 52 52 47 22
42 40 40 37 34 31 33 13 12 32 21 23 22 20 26 31 42
21 35 42 42 35 30 40 39 40 35 47 52 47 52 39 42 35
34 25 10 16 30 27 7 5 10 15 26 39 42 42 34 42 30
14 21 47 35 22 18 21 18 18 14 14 28 22 27 9 8 9
14 28 9 14 22 17 16 20 19 27 27 19 31 20 20 13 9
9 15 23 29 31 22 9 11 11 9 7 8 9 14 17 25 22
22 19 7 15 9 11 11 26 19 20 21 15 11 15 47 44 42
16 10 18 27 20 20 31 18 10 25 19 12 17 8 17 14 9
16 27 14 28 24 28 15 9 25 14 23 9 15 9 42 35 11
12 24 15 19 6 11 16 10 18 22 11 7 9 13 11 22 21
6 20 11 11 6 11 9 8 6 9 18 9 14 22 19 10 9
19 8 7 6 10 24 14 7 6 8 8 11 11 12 9 7 11
19 14 14 10 8 14 8 13 9 18 11 10 13 7 9 9 9
13 19 9 9 8 9 10 15 9 6 9 9 16 18 12 10 13
6 6 11 14 29 20 8 11 13 29 6 10 9 12 12 22 7
13 17 10 6 19 13 11 10 14 7 13 8 6 7 9 9 13
7 11 8 6 10 9 8 6 6 8 8 9 13 9 6 16 19
10 9 9 9 8 9 10 6 7 10 10 14 10 10 9 23 20
9 7 10 13 29 11 11 10 29 6 8 6 12 7 13 12 7
9 8 11 9 7 9 10 6 7 13 9 11 12 11 9 10 9
7 11 9 9 9 6 9 6 7 11 8 14 9 10 9 6 17
10 9 10 14 10 8 9 9 7 10 11 10 10 24 10 13 9
8 10 10 8 11 6 19 14 9 19 6 6 9 9 6