S03036-01_L09
Seqid S03036-01_L09
Sequence >S03036-01_L09.phd
NNNNNNNNNNNNTNTTTNNNNNNNNCNNNANAAGGCGATTGGCGGCCAATCGGCCGAATT
GAGCCAGATTGCAGTGTTTCAGTGATCTTAAAAGTCTTTTTCATTTCTAGCCGCATTGAA
TTCTTTAAAGCAAACCATTAAGGAGTACTTCCCCAGGTTTTTAACCGATAATAAGAGTAA
GATAAAAGTACAAGAAGACAGGGAAATGATTGCTACACCTATAAGATTAGCAAAGAGTGC
ATATGAGCCGATGATAAAATTCGTCGGTACAAGGCATCCCTTAGTGAAGCATGCAACTGA
GGTCGTTGTTCATCCTTGCGCTACCAACGGAATGTTACCTGGCAGCAAAGAGTGTATTCC
AGTGAGTAAATTCATGGAAAATTATAAACCATTCCGTGTAGTGCCAATAAAGCATAGCGC
TAATGCTGGTCTCAGCTCGTCAAAGACCTCTGTATTCGTTAACAGGCCATTGCAAAAAGA
TGAGCTTGCTTCCATTTTTGAGCTACCTGCTAGGTTTCGGTACAAACCTATTAACCAGGC
TGGATTGGAGAGCATAAATAACCAGTGGTGCATGGGGAAAGGAAAAACAGCCCCCCCCAC
CAAGCATCTTAANGGAGGAGAGAGAGGCAANAATAATATTATTTCGCACGTGTAGAAGGT
GGTGTCCGGGGGAGANAAGCTNNCTGGGGTGGGNTTNTNAATANTGTNTNAAAAAAAAAA
TTCTTCATACACCAACCCCCGCGGGGGGGGGAGAAGGAAATTTTTTTATAATAAAAATAA
AAAAAAAAGAGGGTTAATATCTAGCCTGAATCCGCCCGAAAATTTTAAANAAAAGAAAAA
AACACAACCCCCCAACCCCCAAGCCGGGGGGGAAGAGGAAAAAAGAAAGAATTCTCTCCC
ACAACAAACCACACCACAGGCACAGGTACC
Quality >S03036-01_L09.phd
2 2 3 3 3 3 5 4 2 2 3 5 14 5 17 15 19
6 7 5 7 5 5 5 3 9 3 5 3 10 7 8 8 17
14 9 13 25 12 33 32 16 13 29 25 18 18 17 16 33 41
42 26 35 50 41 27 18 32 45 37 34 35 37 29 19 40 38
23 40 49 35 38 46 46 51 42 40 36 29 26 36 36 45 35
33 35 28 23 26 26 35 35 46 59 46 37 37 37 35 40 42
17 42 42 35 39 28 25 32 20 37 29 39 29 27 29 29 28
39 30 43 42 39 42 44 42 42 33 43 49 54 49 49 47 45
50 53 45 49 49 50 51 50 54 54 50 44 58 63 63 63 63
43 47 50 63 63 60 43 60 50 54 60 54 51 60 63 63 51
63 60 58 58 60 63 60 58 54 50 49 58 49 49 60 60 51
54 63 54 49 47 50 54 58 60 49 45 47 60 63 63 63 63
63 49 47 63 52 44 60 58 50 50 60 60 35 63 63 47 50
49 47 60 47 45 44 50 50 49 49 60 44 43 60 50 60 50
58 47 49 60 44 43 60 51 49 49 63 43 51 50 50 45 47
60 60 47 49 50 60 47 47 49 60 50 58 60 44 54 28 50
49 63 50 50 49 60 60 63 60 49 60 44 57 58 60 63 47
60 60 47 49 60 44 63 54 59 54 57 19 45 50 42 50 42
49 49 43 47 43 39 42 43 54 43 49 49 50 42 50 50 42
44 54 27 54 39 39 42 49 49 36 54 34 46 42 36 50 42
54 54 44 42 36 42 18 30 42 39 49 42 39 54 22 42 30
43 43 43 39 43 42 46 43 39 42 42 50 54 42 53 42 39
49 51 54 39 49 50 49 36 54 39 54 29 43 35 42 39 39
50 50 30 49 36 50 54 43 39 29 42 44 25 43 31 59 44
42 49 50 39 39 42 39 54 39 50 39 42 42 39 54 50 54
44 42 42 50 22 39 42 31 43 34 39 39 36 31 35 28 16
54 57 50 59 26 54 46 44 44 54 44 59 44 44 42 19 31
44 16 24 23 16 25 44 25 44 35 33 35 35 31 16 27 34
35 47 35 44 25 22 32 23 44 29 33 44 14 20 25 22 19
14 23 35 46 35 17 27 15 15 14 25 18 21 25 23 41 19
41 16 11 34 52 57 52 19 26 33 36 32 46 35 36 27 11
27 32 41 34 34 15 11 10 8 18 14 10 9 9 14 19 17
19 46 25 23 24 9 18 16 24 11 19 13 24 20 9 15 14
18 11 18 11 8 13 17 19 14 20 17 11 10 18 10 12 20
40 25 11 14 23 37 40 46 32 16 14 17 13 14 14 13 15
17 15 13 17 13 13 14 11 14 8 13 14 15 14 13 14 11
7 20 29 13 26 28 16 16 9 9 10 15 15 20 17 17 19
11 7 16 18 19 20 21 11 13 11 11 13 14 15 14 11 9
10 11 11 15 11 13 15 13 13 11 11 10 26 24 17 27 11
14 11 9 10 10 23 40 28 20 10 10 10 6 9 10 10 11
11 7 7 14 11 10 14 11 13 8 16 15 11 7 13 9 6
11 7 11 10 9 11 7 9 10 10 7 11 6 10 9 15 10
23 23 19 17 14 19 14 20 14 14 14 10 16 13 11 10 10
19 16 13 25 11 11 13 11 16 13 14 14 10 15 17 14 19
28 40 13 11 20 17 14 22 21 17 23 9 9 14 11 20 27
32 27 25 24 20 27 13 11 20 23 16 15 13 13 11 10 9
20 20 25 27 25 20 20 13 11 11 14 11 17 20 13 16 18
20 17 17 20 25 18 19 17 22 18 19 20 16 19 18 15 16
19 14 13 24 15 10 11 9 9 14 14 14 11 7 14 16 27
24 11 16 17 32 27 17 18 17 17 19 24 22 23 17 32 32
20 20 25 19 16 22 17 23 17 15 14 21 16 23 18 18 16
15 28 23 28 15 11 14 11 26 24 24 32 25 25 19 27 25
19 19 15 18 18 20 23 22 16 20 23 18 17 16 27 22 19
18 20 28 15 14 16 16 14 16 17 18 23 12 10 15 20 18
11 11 16 18 19 21 20 20 18 18 18 15