S03036-01_L10
Seqid S03036-01_L10
Sequence >S03036-01_L10.phd
NNNNNNNNNNNNTTTNNGGGCNNAANNNNTGGGNGATTGGCGGCCAATCGGCCGAATTTG
GATCGGTTTTTTTCTCTGTATACTTAAAAGTTCAAATCAAAGAAACATACAAAACTACGT
TTATATCAATTAATAATGTCTGAAATTCAAAACAAAGCTGAAACTGCCGCCCAAGATGTC
CAACAAAAGTTGGAAGAAACCAAAGAATCTTTGCAAAACAAGGGCCAAGAAGTAAAGGAA
CAAGCTGAAGCTTCTATCGACAACCTAAAAAATGAAGCTACTCCAGAAGCTGAACAGGTG
AAGAAGGAAGAACAAAACATTGCTGATGGTGTCGAACAAAAGAAGACCGAAGCTGCCAAC
AAAGTTGAAGAAACTAAGAAGCAAGCTTCCGCCGCCGTCAGTGAGAAGAAGGAAACCAAG
AAGGAAGGCGGTTTCTTGAAGAAATTGAACCGTAAAATTGCTTCCATTTNCNANTAATCA
CCNNTGNATCGGGGTGCACNTTACAAGAGGTNGCGTTTTNTANNTTTANTTTTAAAAGAA
AAGGAGAAAAGNNACAAGTAATTGNGAACATTTTAGGNAAAAAGAAGAANTAAAAAAAAA
AAANNAACCAACAAAGGNNGGGGGGAAGAAGGGGGGAANTATGNTTATGNAATNGAGACA
AGTCATAAAAANCGGCGAAGTGNNNGGAGGGGGGGGGGGGGANGGAAGNNTNNAATTNAN
ANCACACACTCACACAGAGGGGAGAGAGGGAGGTGAAGAAAGATTATATATTTATTTGTC
NNTNTATTATAATTAGNNNAAAAAGAANAAATAGANAGNNGATNGNTAGAAACNCATGTT
TNNGNNATNNNNNGAAGNGNNGNGCNNGAGNGAGGGAGAAGAAAGTNTNTTATGTTCTNA
TNGATAATAATNAAANGNNNNNNTCTAN
Quality >S03036-01_L10.phd
7 4 3 2 3 2 4 3 3 3 5 7 11 21 10 5 5
12 14 9 9 5 5 8 9 7 7 3 5 8 9 10 10 7
20 30 13 31 31 21 16 26 15 11 9 9 9 28 32 32 25
36 31 21 26 12 24 43 27 15 15 15 19 35 30 29 32 38
54 46 49 42 38 35 30 30 30 39 21 36 35 22 25 36 29
25 23 19 42 44 47 44 44 27 24 24 34 35 13 13 24 30
39 34 17 28 15 22 17 29 13 19 22 22 20 25 17 47 28
42 41 25 27 35 41 41 42 41 42 57 34 35 35 47 35 42
46 52 57 57 60 60 52 60 60 52 57 52 42 60 57 52 57
52 57 57 60 57 57 52 52 42 47 52 60 60 60 60 52 40
52 52 52 60 52 52 52 60 47 42 46 42 60 47 46 46 60
40 40 60 60 52 57 52 60 52 63 58 52 52 52 52 63 58
57 52 42 42 57 60 60 57 57 52 44 34 29 29 47 34 28
37 44 42 52 44 40 40 35 52 40 34 34 35 47 46 43 40
32 32 34 22 28 42 42 42 43 47 35 42 57 60 57 57 54
60 57 52 60 44 47 41 47 57 40 40 60 46 52 60 57 52
52 57 57 57 60 58 63 60 52 57 57 52 42 57 57 57 43
57 60 57 57 54 60 57 52 53 60 57 52 52 52 48 48 43
57 60 52 52 57 57 60 46 60 60 57 57 57 52 57 60 57
60 57 52 41 57 52 40 60 60 42 35 52 48 35 28 43 47
47 41 43 36 35 48 35 35 35 35 24 18 43 40 43 43 43
32 45 43 35 47 45 45 60 48 48 52 36 22 45 31 48 53
53 52 48 46 52 57 60 57 53 44 53 53 53 57 53 53 35
53 44 35 37 53 53 53 44 35 27 53 44 27 24 53 57 45
53 23 25 30 21 43 57 42 53 53 53 31 53 53 38 43 9
9 13 21 41 24 47 24 24 45 38 38 30 35 29 29 42 53
53 45 42 43 53 35 19 21 27 16 16 28 45 42 37 30 25
27 13 32 28 22 12 11 19 19 14 7 9 6 11 6 9 9
11 9 19 16 16 9 6 7 10 10 6 12 12 8 10 9 16
10 9 40 11 13 9 6 16 14 14 11 8 9 9 14 10 10
11 6 10 9 9 18 11 9 8 6 9 8 6 7 11 12 13
11 7 9 8 11 10 18 26 12 18 11 15 15 11 24 10 13
28 8 12 19 15 12 11 7 7 11 11 9 11 11 16 10 14
10 18 19 6 10 11 13 8 9 10 9 9 14 14 10 14 6
18 10 10 14 9 11 10 9 9 12 14 6 9 9 10 8 9
9 10 11 10 8 10 10 13 6 6 11 11 13 11 9 11 10
10 10 10 12 12 6 6 19 8 18 17 18 17 13 9 9 9
17 18 11 9 28 9 16 9 12 6 11 16 13 11 6 10 11
10 10 8 7 9 11 8 6 17 15 10 17 14 16 9 9 8
16 14 12 10 11 9 10 9 6 9 8 9 13 9 9 20 22
9 9 7 5 5 11 10 10 11 22 20 15 9 17 12 12 12
18 12 27 9 9 6 12 8 12 10 9 6 6 10 6 6 17
10 8 8 6 9 7 9 7 10 8 9 18 9 10 11 12 11
18 10 9 9 10 11 12 13 8 15 16 11 12 20 20 10 11
29 17 17 11 16 9 11 10 10 16 14 9 11 8 12 8 17
18 16 13 15 9 8 18 14 12 9 16 21 17 12 9 5 6
11 7 18 11 18 10 15 10 12 10 9 10 9 9 6 6 6
8 9 15 19 10 11 10 12 7 10 27 26 15 27 9 13 6
8 8 4 7 9 14 12 7 9 7 10 8 13 16 22 9 9
7 9 16 14 16 12 13 10 6 6 9 6 6 12 9 7 6
5 5 6 9 17 10 9 6 11 6 7 9 7 10 9 5 7
9 20 30 7 9 12 19 11 12 11 18 13 17 17 21 32 17
10 10 6 9 6 15 11 14 23 14 23 22 19 12 7 10 10
6 9 16 11 19 11 8 14 26 12 6 28 23 9 5 9 6
6 5 6 6 6 11 11 10 10 5