S03036-01_L11
Seqid S03036-01_L11
Sequence >S03036-01_L11.phd
NNNNNNNNNNNTNNGGAANNNNNNNNANGGCGATTGGCGGCCAAATCGGCCGAATTGGCG
ATCAATTGCATTCTTTTCCACACCACCTTCAAATTTAAGAATTCATATTTGAATCGAACC
AAGGTTAATACTCTGACAATTTCAAAACGAAGTAAAAAGAAAAATTATCAAATCAACAAA
AAGTACCCGTTACAACAAAAAAAATGTCCCAAACTCGTGAAGATTCTGTTTACCTAGCTA
AATTAGCTGAACAAGCCGAACGTTATGAAGAAATGGTCGAAAACATGAAGGCCGTTGCTT
CATCAGGTCAAGAGTTATCTGTCGAAGAACGGAATCTATTGTCGGTTGCTTACAAGAACG
TCATCGGTGCTCGCCGTGCTTCATGGAGAATAGTTTCTTCGATCGAACAAAAAGAAGAAT
CAAAGGAGAAATCTGAACATCAAGTTGAATTAATCCGTTCTTACCGTTCTAAAATTGAAA
CTGAATTGACCAAAATCTCTGATGACATTTTATCTGTGTTAGATTCTCATTTAATCCCTT
CTGCTACTACTGGTGAGTCTAAAGTATTTTACTATAAGATGAAGGGTGACTACCAACNTT
ANTTANCTGAATTTTCCNGCGGAGAGGGGAGAGGAGAGGCAACANNNTCNTCTATTGAAG
CTTATAAAACCNATTCGGAAATTGNCGCAANNNAATTTGCNNCTACTAAGCCCAATCGTT
TACNTNAAAAANCCCCNCCNNCACCGCCCCAGCTANANGTGTAGAANGNTAGANNAANTG
AAAATAATATANNNNNGAACNCANTATGGAGAACACTGNGTNACTGTANTTATGAGATNA
NTAAAAAAANNGNAACCNATNNAATNAACNGAGCAGAAAGGTACGAACGNNANGTATAGN
NTAAANATTATNAATTATAANTNNCAANANN
Quality >S03036-01_L11.phd
6 3 3 5 3 5 6 5 4 2 4 8 6 6 9 12 10
9 7 7 6 5 3 5 5 7 10 7 9 17 8 19 21 16
27 27 16 17 25 19 16 24 11 14 17 37 31 35 30 40 41
41 32 17 34 37 31 17 20 36 25 24 21 29 41 50 49 49
44 37 42 49 46 40 50 49 45 46 26 16 50 26 46 32 15
35 32 34 49 30 22 34 46 49 49 42 36 27 34 49 35 42
42 30 25 35 31 29 20 27 35 29 32 32 32 44 42 46 36
33 44 43 49 53 43 27 29 36 42 54 44 49 49 51 63 63
60 47 58 63 63 58 45 50 49 58 51 58 59 63 57 50 63
54 60 63 63 63 60 63 63 60 60 57 52 58 60 57 54 59
57 60 63 63 52 60 52 57 57 60 60 58 60 63 57 52 63
63 63 63 58 58 60 41 63 58 42 52 63 58 63 63 63 53
48 63 57 63 53 57 46 57 57 57 57 60 57 52 52 53 57
57 52 46 57 57 57 58 57 57 52 57 52 48 48 47 43 43
48 40 43 34 43 57 52 60 57 57 52 58 60 57 42 63 48
58 57 60 53 60 57 60 60 60 47 52 57 52 63 57 52 63
63 52 60 63 52 53 52 52 63 63 63 47 60 52 60 52 58
57 63 28 53 48 42 53 48 57 52 63 57 47 57 46 42 57
63 46 46 57 58 60 57 47 57 63 42 46 46 57 52 47 57
54 57 63 30 58 63 41 60 57 52 63 47 47 57 47 52 48
43 28 60 48 48 34 43 43 40 40 48 40 60 22 48 60 52
60 52 52 57 57 42 57 57 52 63 60 63 57 57 57 52 52
60 60 57 60 60 63 63 48 43 46 57 60 57 44 52 43 42
57 52 52 63 43 44 52 57 60 47 52 52 52 52 60 63 47
47 63 63 63 43 57 57 58 40 45 43 42 52 44 57 57 47
63 57 60 52 52 52 47 60 44 57 52 52 52 44 57 52 42
45 52 46 63 52 57 58 35 58 47 58 52 60 52 37 46 57
46 35 43 40 44 41 43 47 43 40 39 42 49 60 38 28 41
42 42 47 43 47 33 60 35 33 40 47 40 35 35 40 22 33
21 35 38 35 35 35 36 40 43 21 43 40 27 28 42 49 47
46 40 35 35 42 43 47 47 30 17 19 21 33 21 25 22 26
24 39 42 60 41 16 19 22 22 33 33 42 47 39 35 47 27
33 22 16 21 24 22 27 60 26 19 35 42 24 26 22 24 15
38 33 35 24 18 14 60 47 33 24 35 40 17 46 11 32 42
40 19 32 11 9 9 18 47 27 26 23 11 18 20 27 18 16
12 9 6 10 11 14 7 9 22 17 6 9 19 9 15 12 9
19 13 17 15 12 6 9 10 24 17 16 10 16 9 22 11 9
10 9 19 8 9 9 10 10 11 26 10 10 12 9 10 6 7
6 24 9 6 22 8 9 8 13 16 9 19 9 9 9 9 10
10 17 17 22 37 53 13 11 6 11 9 13 10 11 10 27 35
10 9 19 9 6 20 8 16 20 11 6 6 6 9 11 28 37
13 19 10 6 7 11 10 19 13 10 8 13 9 20 13 10 21
9 9 9 12 14 29 18 9 8 6 9 7 15 15 10 10 11
6 8 9 9 13 6 9 10 6 6 9 10 10 9 10 10 15
21 11 9 9 8 9 11 7 10 6 11 9 11 11 9 14 10
18 7 10 6 18 10 10 9 6 7 10 13 7 11 9 11 11
9 9 11 9 10 15 9 14 10 6 6 7 7 6 9 28 21
11 7 9 8 7 10 9 11 11 13 9 10 9 8 13 11 13
9 13 7 10 11 7 11 11 14 12 8 9 6 9 10 10 9
9 11 10 12 8 7 10 6 8 11 19 28 21 11 15 14 6
6 10 6 12 9 9 11 6 11 10 6 6 9 10 10 7 9
11 10 6 9 11 9 8 10 11 9 8 9 10 8 9 10 10
10 10 11 10 9 6 6 11 7 10 11 9 9 9 11 6 6
9 9 8 10 7 11 8 8 9 9 7 12 11 9 9 12 14
10 8 6 8 6 6 10 10 9 6 12 6 6