S03036-01_L12
Seqid S03036-01_L12
Sequence >S03036-01_L12.phd
TNNNNNNTTTNNNGGNNCNNNNANANAGGNGATTGNCGGCCAATCGGCCGAATTGAGAAG
GCTGGGACAATAAAAATAAAAAGCATTAATTAGTGTAAACTTTGCTCCCAAATGCAAGTC
TAAGGTAAGTTCTTTGGTTCATGGAGTTTTTGCAGTGTGATCTCACGTGCACTAGACTGA
GTAAAGCGAACCTGAGTTCAAGAAATGATGATTCACCTGATGACATATAGTCCAACTATA
CAAGCAATGAACCCTTACGGATTGAAGTCATTCAATGTTCAATGTTTGTTGTAATAAGAA
ATATTACTAGAAAAAGATTTTTTCTTTCGGCGGCGTTTTCCCGCTTTTCTTAAACAATCT
GCAGTTTTAACATCGAATTCAGGAATATTTGTTCGCTAAAGAAATAACACAGAAGAAGAA
ATGAAGAACATACATTGAGGGCGACGAATATAAATGACTTATTACTCCCACTGCTGCGAT
GAAGGATCCAGGACCACGGGNGGTTNANGNTTACAAANTATTAAAGTCANNAAGATAANN
AAGGCGNANCGGGGAGTATNTTAANGTNGGATTGATAAGAAAAAAANCNCTAATAANNTC
AGNCNTCCAAGAAAGGGAAGGGGGGAGTGATGTTTTAAANATTTACGNTTACTGCNATCA
GANGAGNTAGGGCGGAGATAATTAANAGTGGACANAATAGANNAATAAATAACCACNANN
NANNNANAACACANAATGGANGTANAGAGNTNGTTTAGTANTTTNATATTTGGNAAGGGA
AACATANTNNAATGGNNNNANATGANAGGNNATAGAAGAAAGGNAATAAGGCTCCNAANT
AACNGATNAAGGTCAGCTNCGTGAGTNGNANNGAGANAAGNGAAGTATANGNAGAANCG
Quality >S03036-01_L12.phd
8 5 2 3 6 6 7 9 8 10 7 7 7 8 12 6 6
12 6 6 5 7 8 5 9 5 9 10 10 6 10 24 15 19
11 6 10 13 13 11 11 10 9 28 27 15 19 21 21 18 23
12 26 28 12 16 12 15 15 12 27 15 22 33 22 12 13 12
20 27 32 54 54 49 49 29 22 29 28 39 39 27 21 39 39
44 44 47 47 50 44 33 24 28 33 34 34 47 42 52 44 47
29 37 35 27 35 35 30 24 35 28 29 40 35 29 35 42 47
39 42 47 57 34 43 52 52 44 41 52 52 57 60 57 48 52
52 57 52 52 52 57 57 48 52 57 60 60 60 60 48 63 57
54 57 57 60 57 57 52 52 57 57 52 57 52 57 52 52 52
52 52 52 48 35 48 52 57 52 52 52 52 57 60 54 52 53
58 63 63 63 57 48 53 58 52 63 63 58 57 58 57 58 48
48 48 60 52 52 60 52 52 57 52 53 63 48 57 52 52 52
57 52 52 60 57 57 53 45 53 53 47 32 35 35 44 32 29
44 36 45 35 53 60 57 53 60 57 60 52 57 52 60 57 57
48 57 52 60 60 52 52 57 58 57 57 63 63 60 60 53 57
52 52 60 57 63 57 57 52 57 57 58 63 60 60 60 63 52
60 63 57 57 57 57 57 48 60 52 48 48 48 57 52 52 57
57 48 57 52 57 52 48 48 48 53 48 42 58 57 60 60 48
60 57 60 60 60 57 52 57 57 52 45 60 60 44 44 35 43
43 43 44 43 43 44 21 19 44 44 35 35 35 44 36 20 19
26 31 24 37 35 37 44 35 44 29 37 53 53 53 53 53 60
53 52 52 53 53 53 53 20 44 37 35 53 52 52 43 39 53
53 43 60 47 53 37 37 37 37 44 35 53 60 47 60 53 53
53 53 57 45 60 53 42 53 44 29 37 27 29 37 37 53 44
23 37 60 52 46 33 33 37 37 53 53 60 53 43 28 30 32
53 52 45 53 53 46 31 42 35 10 9 12 18 35 40 12 20
18 15 10 9 9 9 9 11 19 9 10 10 11 16 16 13 14
9 11 20 12 17 13 10 20 14 19 15 10 10 8 14 9 9
9 14 34 17 11 11 10 6 12 13 24 31 6 11 6 9 6
11 9 10 11 8 14 9 6 9 11 10 10 11 11 11 12 10
9 9 6 6 9 10 18 9 8 24 24 7 6 9 9 9 11
11 12 6 10 7 9 21 15 18 9 10 9 10 10 12 6 10
9 10 11 6 9 9 6 9 9 37 10 11 8 10 11 14 12
16 16 11 9 11 14 11 13 7 9 6 8 9 9 10 9 9
13 6 7 10 9 14 10 7 9 6 10 11 11 8 10 9 11
9 11 10 11 8 11 8 9 13 9 20 12 9 8 11 8 9
10 10 8 9 11 9 11 9 10 11 6 9 9 12 11 9 11
9 7 14 9 14 9 8 10 10 6 10 9 8 10 9 11 6
10 14 9 7 9 9 9 10 10 9 9 8 15 9 10 9 8
16 16 10 11 10 7 10 9 9 9 10 9 9 9 6 9 11
10 10 10 9 6 6 10 10 9 18 11 9 9 11 11 12 11
13 9 6 11 6 6 6 9 6 6 6 9 6 8 12 9 10
11 9 6 8 11 9 10 9 8 6 9 9 10 6 8 9 11
13 6 9 7 8 14 13 11 8 11 14 8 6 14 14 14 6
9 14 11 14 9 9 10 11 6 14 9 9 8 10 11 8 14
10 8 9 9 6 9 6 6 11 9 9 14 8 6 6 6 6
9 6 9 10 11 9 6 9 8 9 6 6 11 9 10 10 10
10 10 11 11 10 10 11 6 9 9 10 14 14 11 8 10 9
11 8 6 10 10 6 10 9 10 8 6 8 10 9 6 10 10
10 10 11 9 8 8 11 9 6 10 8 11 11 22 11 9 5
11 6 8 7 7 9 11 10 11 6 14 9 11 6 11 11 9
9 9 11 10 9 6 9 6 14 9 14 14 7 9 8