S03036-01_L14
Seqid S03036-01_L14
Sequence >S03036-01_L14.phd
GGNTNNNNNNTNTNNAAGNNNNAAANNNNGANGATTNACAGNANNTCGGCCTAATAGAGA
TCAAACAATATACAATGGATTCNNCCAAGATCTTTAACATTATATTATCCCTTTTCTTAC
CACCAGTCGCCGTTTTTCTAGCCCGTGGGTGGGGTACTGACTGTATAGTGGATATCATTT
TGACCATTTTGGCTTGGTTCCCAGGTATGCTATATGCCTTGTACATTGTCCTACAAGATT
AAGCTCATTCAATAAACGAAAGTAACTATCAAATGAAATAAGGAAGCAGTATTAGGAAAC
GGTATCAACATGTTCGGGTCAACATCATTTTTCTTTGTTTCCTTTCTTTTTGTTTGGTTC
ACGTTCTCTTAAGGTTTCNTCCCCCGCTGTTAATNTTAACAAANNNAGGTATGGTTGAGT
AGTTAATTNNAGTTCTNAAAATACTTAANNAAANACAAACCCCAAANCATNCCCCCCCCC
NGGAGAGGGGGGGGGAGAAGNAANAAGTTTATNTNGNANGTTNANTAAAAANNAGANNGG
AAAGAAAANAAGGNNAGNGGANNATTATGAATAAAAAATAAAAAAAAAAAAAAAAANTAN
ACNNTTATTNCNTNNGCNCACGAAAAAGAGGGAGGGAAANATTTTATGTTTTATTNNTAT
NANATNANAAAAANNCNNAGGAAGGNGGGGCCGGGNGNTNGCTNTTTTTGGNGATNATTA
TAAAAAAAAAAAAAANCATCNNNNNCNNNTANTCTGCNNNAGNGTGAGNGNAGNGNNNNN
ANNGNGANAANNNNNNTNNNNANNNNTNNNATAANAANANNAGCANNANCGANCNGCNNN
CNTNNTNGCTNNNNNNNNTAGAANAGANANANANCTAAATACATCTCNCCTCTCCCTCCT
CCAGCNGNCGNGNNTGGAGGNGGGANNGNGNNGANNGTGCGATGAGTTATTTATTAATTT
NTAGNANTNNATANTANGNN
Quality >S03036-01_L14.phd
11 8 7 8 7 7 5 5 5 5 8 5 8 6 7 16 10
9 5 6 6 6 10 14 10 7 5 5 6 10 8 5 9 19
14 11 7 9 10 11 12 7 9 7 7 11 9 9 8 14 13
15 13 9 9 9 8 8 12 9 10 9 11 10 11 11 10 9
13 9 9 11 9 11 19 14 20 19 11 9 13 16 6 7 9
17 23 22 15 17 20 23 9 9 12 10 8 19 11 16 9 18
11 11 21 14 10 10 11 10 11 10 18 23 19 14 15 19 19
18 9 8 41 37 35 22 16 13 14 16 18 9 18 41 47 42
42 31 29 18 15 41 40 41 32 41 53 40 46 34 53 53 34
41 40 45 35 45 44 30 27 24 45 18 19 32 18 35 39 53
27 30 27 19 33 24 36 42 53 35 38 31 42 35 29 32 45
53 53 53 34 28 24 32 24 38 27 47 53 42 47 52 37 24
45 27 31 24 35 35 27 28 28 16 23 23 31 31 19 21 40
13 22 35 31 37 35 35 11 10 11 10 20 10 11 14 20 37
13 14 24 19 33 47 45 41 30 43 39 23 13 17 25 27 27
23 18 13 24 18 23 24 45 39 47 42 45 53 44 38 35 53
53 53 28 37 60 53 30 53 42 30 37 42 42 35 30 27 35
24 33 39 31 35 45 53 45 47 31 25 25 30 42 42 21 16
18 23 36 27 42 53 42 23 33 24 33 35 42 42 25 13 12
10 19 28 37 53 53 53 42 44 44 41 41 42 27 27 38 31
23 27 20 33 17 16 12 19 40 38 14 10 9 12 9 16 9
10 9 10 8 9 9 12 18 20 15 32 16 19 19 37 42 37
14 8 11 11 6 16 14 11 11 13 12 9 14 23 12 28 23
11 16 8 7 14 24 24 24 12 9 18 9 6 6 7 11 8
19 12 21 13 9 9 9 10 10 11 9 11 14 10 18 16 13
9 9 9 6 6 8 9 11 9 9 9 7 9 11 12 14 9
24 9 28 10 10 31 6 6 9 18 9 7 19 11 13 11 14
8 11 9 9 9 11 9 6 14 11 9 6 9 9 14 25 16
19 16 14 11 6 9 14 11 11 8 11 9 13 8 8 8 12
23 13 10 9 10 8 11 6 13 11 6 8 9 9 11 9 10
10 8 6 11 7 8 6 9 6 9 11 11 6 13 7 9 10
10 34 15 16 7 6 9 10 10 6 6 8 9 11 15 9 9
16 9 15 13 6 9 9 9 9 6 6 9 9 6 10 9 11
6 6 9 9 9 11 10 16 11 11 12 21 12 16 21 11 11
8 24 37 32 39 36 18 42 53 32 28 39 41 16 12 24 9
10 6 9 11 6 9 9 6 7 11 11 8 11 10 6 11 6
9 7 6 9 11 6 11 9 9 13 10 9 11 9 10 10 10
8 8 13 9 15 18 12 12 19 20 6 12 8 11 10 9 9
9 10 9 12 12 14 8 11 9 6 6 9 16 13 6 8 7
10 11 6 18 7 17 12 28 35 24 6 5 8 5 7 11 8
11 12 9 9 9 6 13 14 13 14 14 18 15 13 18 7 8
7 11 6 10 8 9 7 9 18 15 14 14 10 11 7 10 10
10 7 26 17 13 27 16 15 14 20 25 27 30 18 27 12 28
30 12 12 13 6 9 9 9 9 7 6 6 7 6 9 6 6
6 9 10 6 9 11 9 9 10 6 6 6 14 11 7 17 11
9 9 10 7 12 6 11 9 5 8 5 5 5 6 6 10 6
6 11 6 15 15 5 12 9 5 3 5 3 3 3 10 6 5
3 3 11 7 5 5 7 9 6 7 6 16 11 33 9 7 31
40 6 14 6 6 14 14 16 18 5 7 9 6 8 23 15 6
9 7 8 13 6 6 6 10 6 12 7 7 16 6 12 9 9
6 5 6 7 5 7 5 6 13 28 12 12 17 7 28 9 25
5 15 6 19 5 8 6 9 11 9 28 12 8 14 8 8 8
8 13 9 7 13 10 8 13 28 9 20 13 10 15 12 15 11
23 11 9 9 7 15 7 9 11 6 12 6 6 8 14 14 10
12 9 7 10 23 13 12 6 5 8 6 12 7 7 8 13 6
6 22 11 23 13 22 24 9 8 12 14 11 11 10 13 19 9
12 8 27 11 10 8 9 16 6 11 14 8 6 16 6 14 6
6 9 16 10 7 9 14 6 9 6 5