S03036-01_L15
Seqid S03036-01_L15
Sequence >S03036-01_L15.phd
NNNNNNNNNNNNNNNGNNAANCNNNATNNGGCGATTGGCGGCCAAATCGGCCGAATTGAT
AGTTTGTAAGATATAAGACAAAACACACCTGCTTTTCCACTACACATTTTCGTTATTATA
TAAAAAAAGACAGCCAAGTATACTTGTCAACAAAATAAACTCATAGCAATTACACTATAA
AAACAATAGCATCAAAAATGTCACTAAGAAACATATCAATGATCACAAAAAATTTGCAAA
CAACTGCCAAGTGTTATGTCCCAAAAAGTTCACCTACATCAACAACTATTCCGGTTATAA
GGGATGCTAGTACTACTCAATGTCGCAGAATAACTACCGTCATCAATATTACGAGTCTGA
AAGGATATTCTCCATCTCCAAGAACAGTTCATGATAAGCCAATTGTTATTTGCACTGACA
ACGAAGAGGTAGAGACCGTATCGGAGCACGTAAAAGTATAATTTGAATTAATCTACTCTT
AACACTGTTCAAATGTACGTGTAACGTTTTGACGCTAAAAGATTCTAAAAAATTACTTTT
TAAAGTTATACCCTCTGACTTTATGTGACATCAGCATCCTAAGTACCTACCGTTCATAAT
TTGACGCTTTTCCTTATACATTCAAGCATCGATATATATGATTTTTATATATGTCCTCTA
TTCTAATACATACTTTTTTACTTTTGAAATAACAAAATNNTCTTTTTNNNNANNTAGNAC
AANNNANNACCACNGANAGAGAGAGAGNANNNGGAGGGGTTCCGGCCATAAGGGCCAGCT
GGAGATTTCNNANGGCCCCAAAATAACTTGGNGNANACGAGGNAAAAANNGTTTCTTGTG
TTAAATTTNTTCCNCTCCCANTTCCGCAGNNAGNAGGNGGGCGGAGGTNAGNGTGNAGAG
CCNGGGGGGANAANGAGGGAGTTCACTN
Quality >S03036-01_L15.phd
7 5 5 5 4 5 5 4 5 6 6 3 2 4 6 13 7
5 9 8 5 8 7 5 3 9 9 5 6 24 23 10 18 29
14 25 31 18 17 40 26 17 27 9 14 27 42 35 42 22 36
41 41 28 26 30 40 35 17 25 30 38 35 43 48 50 30 31
31 42 35 22 44 30 51 50 49 42 32 37 45 49 50 49 32
52 35 50 49 50 52 49 49 46 49 35 49 39 16 44 42 42
43 42 43 42 49 49 40 32 46 43 46 42 46 47 42 54 54
59 54 49 54 54 49 49 49 54 54 42 46 50 54 54 42 50
51 50 57 54 57 54 57 51 43 53 50 50 50 57 50 50 57
53 53 54 51 53 53 53 57 57 50 57 57 49 43 51 52 51
43 46 57 59 57 42 42 45 47 51 46 51 51 57 42 59 57
57 53 57 57 57 57 49 53 53 53 53 49 53 57 53 49 45
45 53 47 46 50 49 50 54 54 54 54 54 50 49 49 50 54
44 46 49 43 57 54 54 49 44 44 44 44 46 44 44 44 44
42 46 49 47 49 44 46 47 60 47 60 54 50 51 60 43 63
60 50 51 54 54 60 49 47 49 58 51 60 50 60 58 47 42
50 51 50 60 49 44 60 50 44 63 60 44 58 60 50 54 54
60 49 49 60 63 44 63 60 42 44 57 54 53 51 42 24 54
44 46 44 43 59 46 44 50 42 42 42 44 31 57 42 54 34
42 44 42 42 22 51 57 34 44 54 54 42 44 43 50 50 42
42 35 50 42 27 54 42 50 39 54 43 50 35 54 39 39 44
59 59 34 49 46 36 57 39 22 54 36 57 50 42 50 49 35
54 43 50 42 54 35 57 39 51 49 39 39 54 54 57 42 43
54 50 44 39 50 57 54 59 54 44 57 50 57 54 30 49 50
36 53 53 50 46 34 44 43 57 52 42 34 59 54 34 59 59
30 59 31 50 35 50 42 54 34 50 27 50 54 54 54 43 46
46 53 54 17 50 42 41 54 50 44 57 57 57 30 54 43 35
43 59 31 57 54 42 35 49 39 50 30 50 43 46 42 46 54
43 54 43 49 42 54 43 35 42 49 49 32 51 31 30 49 49
35 49 24 46 36 37 49 49 43 43 46 35 46 37 57 57 57
43 54 35 35 46 43 22 53 57 57 30 38 16 57 35 37 35
53 51 51 51 49 30 51 35 37 46 52 49 52 49 35 49 49
42 28 49 42 41 40 32 49 49 35 37 42 46 42 22 41 52
49 35 37 52 33 46 42 35 35 41 36 46 36 37 34 30 29
49 30 36 49 32 41 32 28 49 32 34 31 49 46 34 46 22
22 34 22 49 21 46 49 42 41 28 34 32 28 49 46 49 31
43 30 37 40 21 37 34 30 32 50 34 18 42 38 38 33 26
38 40 40 27 37 30 40 37 24 29 44 34 12 50 42 40 31
42 27 43 32 43 31 38 31 22 40 38 38 34 42 13 40 35
28 31 32 20 35 31 31 38 50 40 23 37 37 37 40 25 27
21 30 50 48 42 43 14 28 30 26 42 18 35 19 25 25 18
10 7 6 27 16 13 30 30 34 17 5 5 5 5 9 6 6
8 10 9 6 11 10 8 11 7 6 6 9 6 7 8 8 14
16 8 6 9 16 6 13 9 12 14 22 22 14 17 26 9 6
10 6 7 5 8 16 12 10 9 10 17 17 10 12 19 23 19
16 13 15 11 14 18 17 40 13 14 17 15 10 11 15 10 11
16 10 14 14 12 11 12 7 7 8 6 16 25 18 16 22 21
16 19 13 29 14 18 9 12 20 23 26 14 6 14 6 30 6
15 14 11 11 27 9 7 13 12 19 10 9 7 5 18 21 21
15 14 18 13 16 9 10 10 9 31 14 12 19 12 14 6 10
17 11 9 6 19 11 17 12 16 17 6 10 15 10 18 19 20
13 8 6 6 12 10 7 14 16 9 6 13 12 13 8 17 15
18 10 21 10 7 27 11 7 9 11 10 7 25 12 21 9 9
13 7 10 24 10 16 9 10 10 7 15 20 7 17 10 14 13
13 27 14 18 11 10 24 14 13 7