S03036-01_L16
Seqid S03036-01_L16
Sequence >S03036-01_L16.phd
NNNNTTTTTNGGGNCCAANNNAAANAGGNGNNNNGNCGGCCGNTCGGCCGAATTCCCATG
GGGATCCGATTTGCCGACACATTGAGATCCGGACTGGACATATCCACTTTATTAGCTGCG
AACACCGTCCACGATGCGCCATCTGCTTCCCATCTTCCGTTCGATATCAATGACCCTGCC
GTCCTGAACACGTTGCACCATTTGATGTTGCACATGCGTTCGATATACCCCATCAACGAT
AGCTCCAAAAATGCAACGGGTATTGCCCTGGGCCGGTATCCTGAGGACGTATATGATGGA
TATGGCTTTGGCGAGGGAAATCCCTGGGTCCTGGCCACGTGTGCCGCTTCAACAACGCTT
TATCAGCTCATTTACAGACACATCTCTGAGCAGCATGACTTGGTTGTCCCAATGAACAAC
GATTGTTCGAACGCATTTTGGAGCGAGCTGGTATTCTCCAACCTCACGACTTTGGGAAAT
GACNAAGGCTATTTGATTTTGGAGTTCNATANNCCTGACTACAAACAAACCATACAAAAA
GTTTTCCTACTAGCTGGATTCAGNAAAGGNAAANCTGAACCCTTCCCTGCGAGNNGGCGG
GNAAAGGGAAAGGNNATTTTAATNNTTNCCNGGGTTTAGAAAAAAAAAACNACAGGTATC
NTGTCTATANTTNATTAAGTTGGTAAAAGAAAAAAAAANGNCGGCCCCCCCCGTGTGGGG
GGCAAGGAAGNNGGGAAAAGAAAAAAANTNNCCCATNAGANTTTCGACAAACTAANAANG
ANGAAAATCGAAAAAAAAAAANTAAANAATNGTAGNACAACAACTGTCNCCAGCNGTAGA
ATAAAATCGAAGGCANAATAAAANAGAAANATNAAAGAAAAANGNAGANGGAGCTCNNGG
NNTTCTAGGATATGAG
Quality >S03036-01_L16.phd
4 2 2 2 11 19 24 21 16 5 8 9 15 7 9 14 8
9 5 3 3 8 8 8 5 9 8 8 5 9 5 5 5 7
9 5 8 13 19 13 12 8 7 27 31 34 28 38 31 27 26
17 34 35 21 17 19 25 35 43 40 37 37 13 17 28 31 26
43 30 40 37 31 35 50 42 46 52 28 49 21 15 12 11 8
9 31 32 46 35 28 34 23 31 35 38 46 32 35 28 35 28
30 37 27 27 42 42 43 34 42 50 44 44 42 49 50 49 49
50 50 42 39 35 30 36 38 44 49 42 54 49 44 50 50 54
50 49 50 50 44 49 49 54 57 50 54 50 60 60 49 44 63
63 60 44 49 49 49 51 45 47 49 51 54 54 52 49 49 49
57 57 45 50 49 49 50 57 54 49 50 50 54 54 54 57 54
54 54 54 51 51 53 43 53 53 49 50 50 44 59 54 50 49
44 44 54 50 49 50 54 42 42 36 42 43 43 42 46 42 46
36 44 39 39 39 39 39 35 39 46 44 50 50 47 60 60 49
51 50 60 49 60 49 49 47 47 49 49 49 43 33 42 47 60
60 60 50 60 59 60 54 42 51 63 50 63 49 51 63 51 51
49 60 49 63 51 49 49 49 43 47 58 45 38 51 45 31 49
60 47 49 49 47 49 50 44 50 44 50 42 47 42 49 50 47
60 49 49 47 45 47 49 50 42 50 60 45 41 41 40 47 43
41 44 50 41 43 49 49 43 42 47 35 33 41 22 47 27 21
25 38 43 35 27 30 23 33 29 28 23 21 19 22 27 36 38
42 60 60 47 60 47 57 42 34 60 57 52 60 52 60 52 47
46 39 60 52 60 42 60 46 60 60 57 60 57 52 52 29 60
57 42 52 57 52 57 52 52 57 60 57 47 47 57 57 44 57
43 41 24 52 57 60 48 43 32 30 34 42 35 47 40 48 57
41 46 42 29 48 30 23 32 27 20 47 39 39 41 47 40 60
19 40 29 21 21 29 42 42 40 32 28 32 37 30 24 16 11
9 13 28 27 23 32 15 42 25 30 35 34 35 32 37 19 10
11 11 32 18 21 23 18 7 15 21 14 32 20 35 20 35 44
20 29 34 26 44 35 35 20 26 39 12 28 19 13 6 11 20
11 6 6 9 10 21 19 9 9 11 10 9 11 19 10 9 9
13 9 9 13 9 11 9 14 10 19 18 13 18 10 19 10 19
23 10 13 9 14 13 23 23 9 24 25 19 28 45 11 13 12
9 10 6 9 14 10 11 13 6 11 21 13 6 21 12 9 18
16 10 10 9 8 11 12 19 19 12 9 9 9 14 9 6 7
10 9 9 9 12 11 7 10 13 14 18 22 11 9 9 9 13
11 6 6 11 9 24 35 12 11 14 8 6 6 9 8 6 9
11 6 16 13 10 9 11 12 10 10 10 22 13 21 16 13 10
15 14 8 11 6 11 14 9 10 10 13 20 10 9 6 9 11
11 14 12 30 9 14 7 14 9 6 11 14 15 11 9 12 11
9 9 10 9 9 15 26 11 11 19 32 10 19 22 19 11 12
9 6 9 6 9 8 10 9 11 19 19 19 16 11 14 9 9
9 10 13 10 11 9 9 11 14 11 10 9 10 15 13 9 6
6 10 9 14 11 18 12 19 11 18 14 17 10 9 14 10 6
9 6 6 14 10 18 12 11 6 11 11 13 7 9 10 11 9
14 15 17 14 24 11 9 11 10 9 6 8 12 6 9 11 6
9 11 9 9 13 14 12 10 15 9 16 12 10 12 18 12 10
9 11 7 9 16 11 10 6 10 8 9 6 8 8 9 9 6
14 9 14 36 10 9 9 11 11 10 9 11 6 19 10 10 8
10 6 10 11 9 8 11 13 10 14 16 25 9 9 11 14 19
14 14 10 9 9 7 9 13 15 17 14 9 11 6 11 10 14
23 9 6 9 9 6 9 9 9 9 20 10 10 9 10 6 11
6 9 9 8 6 11 10 15 12 11 10 11 6 6 11 10 7
6 8 9 9 9 9 9 11 10 11 11 9 10 11 9