S03036-01_L17
Seqid S03036-01_L17
Sequence >S03036-01_L17.phd
NNNNNNNNNNNCAGGGNCCGAAAAAATANNNNGATTGACGGCGAATCGGCCGATTGATAA
ATTGGAACACTGTTCCAAGATGTTACCGATGCATGCAGAAGTTTGGGTAACCACGTCATG
GGTATGATTGAAGATGATCATTCGACTTCGCAACAACAGCAACCATTGGACTTCACATCC
GAACACACATTGAAGACTGCCGAAATGGAACAGCAAGTGGAAATTTTGAAGTTAGAACAA
TCCTTGAGCAATGCCAGGAAGAGATTGGGCGAGATAAGAAGGCATGCCTACTATAACCAG
GATGATGATTGATCATGATTTGTACTTTTTATATATAAAGATAAACGTTAATATAAATAT
ATTTATTTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAGAAAAAAA
AAAAAAAGAAAAAAAAAAAAAAAAGGGAAAAAAAAAAAAAAAAAACACCTTNCGGGCCCC
CCGCGGGCCCGNGGGGAATACTAAAAGCCCCCCCTATTCTTTTGTNCGTTTCGCANGNAN
NAAGAATTGGGTGNGGNANANTGANTTCTGGTGTAACTTAGTAAAAAAAAAACAACCNAC
AAATAGATTAGGGGTNGANCGGNGGGTNNGNNGAGNNGGGGAATNAATTAGNTTTTAGNT
CCTNTTNANAAGAAAANCAATAAAANNGGGGAAACTTTTTTTGTTNTTNCTGATGTTTTN
ATGNTAANANCAAAAAAAAACCTATACAGCTTGANAANATTAAAGAAAGNAANNATANTN
NTATTNNACTTGNTANAATCNTACGANANAANGACGAANGNANGCTGNGAANTATATGGG
TNGGTTTNANAAAAGAANGGACCGTNGCNTCGACCCCACNAGAANNNNGGNGAGAAGNAN
NGATAAAANNANNNANNTANTGTTANNATNNA
Quality >S03036-01_L17.phd
4 2 2 4 6 7 5 4 5 6 6 9 9 10 10 10 6
8 9 9 9 8 8 9 9 11 10 10 6 5 5 5 8 11
9 12 12 11 13 12 17 10 9 9 10 27 17 17 15 19 22
16 18 12 20 12 9 18 11 13 14 18 25 27 18 18 22 21
13 18 33 33 22 31 17 14 11 29 42 33 32 23 18 12 22
39 44 35 40 57 57 42 20 22 30 35 18 22 30 22 27 30
28 23 40 60 34 34 37 35 29 46 32 60 46 47 53 39 45
52 42 48 48 39 34 45 45 34 47 45 45 37 47 52 33 53
53 37 43 24 52 57 60 45 52 52 60 57 57 45 53 36 53
53 57 52 52 53 53 53 53 60 57 53 45 53 53 53 45 37
35 53 53 53 41 53 53 53 43 43 53 52 53 60 53 57 37
53 57 63 53 53 63 53 53 53 27 53 53 53 53 52 53 43
43 57 53 43 27 30 44 20 44 43 19 35 53 53 53 44 37
53 53 53 53 35 35 32 34 22 29 27 29 27 31 27 29 29
34 31 53 53 53 53 53 43 41 27 43 53 53 53 53 32 37
28 44 53 48 57 52 53 53 40 26 53 53 60 53 43 43 53
16 48 27 53 53 42 43 39 53 53 41 53 53 53 38 53 53
60 53 53 52 53 45 60 57 53 35 60 53 37 22 43 37 19
39 37 27 43 53 53 37 53 53 53 53 53 27 43 39 35 38
44 53 53 53 53 53 41 32 53 53 57 53 60 53 53 39 39
43 28 29 39 30 27 31 53 28 34 28 37 44 39 29 28 23
28 30 29 31 30 30 29 28 43 53 53 57 27 48 48 16 31
16 27 24 18 11 16 11 10 11 14 12 13 10 12 13 15 23
15 14 23 16 18 22 33 47 27 24 32 18 47 13 14 22 11
19 22 14 19 11 12 14 14 10 18 16 12 10 11 13 17 12
10 10 13 11 14 16 12 19 14 22 32 13 10 22 22 17 11
22 10 9 10 9 11 13 15 14 31 24 33 20 16 18 26 47
24 20 26 10 19 13 10 8 12 10 8 9 6 8 9 9 8
11 24 19 13 9 11 10 9 9 13 13 13 11 10 9 6 22
18 10 19 11 19 9 10 10 19 28 13 11 9 12 11 9 9
13 16 24 10 9 19 13 11 11 9 10 12 13 11 9 6 9
10 11 11 10 10 11 9 9 6 9 7 8 6 6 8 12 10
12 10 9 12 13 11 11 10 13 6 9 16 6 9 6 9 6
8 10 10 6 8 12 11 14 11 10 10 10 11 10 10 9 9
14 12 10 8 9 10 9 14 12 10 10 11 16 10 8 9 9
8 9 6 11 11 10 16 12 10 16 9 9 10 9 9 11 10
14 10 10 7 11 10 6 8 11 11 6 12 19 18 9 6 6
9 6 6 9 8 10 6 6 10 17 14 11 11 10 8 7 11
11 10 13 16 10 6 11 11 18 10 13 11 6 9 10 11 11
6 10 8 6 11 7 10 11 9 13 14 11 14 7 15 10 9
13 11 11 9 8 6 7 13 18 27 9 9 8 11 9 11 16
20 19 11 19 13 8 9 10 7 11 18 7 8 9 10 9 9
11 15 11 11 11 7 19 11 8 6 11 9 20 7 11 7 11
14 10 11 19 11 14 24 27 8 9 11 9 10 9 10 9 9
13 11 22 11 14 12 7 10 9 7 11 9 8 10 10 13 18
9 8 14 13 7 10 8 6 6 16 14 14 7 8 6 6 11
14 11 9 6 6 8 8 9 14 9 6 9 8 7 11 22 11
10 6 9 11 9 11 20 6 14 6 16 8 6 9 20 9 21
10 11 7 8 7 10 6 10 8 8 9 6 9 18 9 7 19
12 9 9 9 9 10 9 9 6 9 10 10 11 17 6 10 6
9 9 12 15 8 9 17 6 8 12 9 8 8 8 8 6 9
10 6 9 9 8 8 9 13 9 9 9 13 6 12 13 12 8
6 6 6 6 10 10 7 21 16 16 9 9 16 7 9 7 7
8 11 10 11 9 8 14 7 6 10 6 7 6 8 6 6 23
21 6 19 13 10 8 9 6 6 10 10 7 7 9