S03036-01_L19
Seqid S03036-01_L19
Sequence >S03036-01_L19.phd
GGNNNNNNNNTNNNNNNNCACNNNCNANANNGGTNCCCGGCGGCCGGATCGGCCGAATTA
AGCACGCTAATTTAATATCGATTTAAACNTGAAAGTATCACAAGTTTTCATTTCTGCCAT
CTCTGTCTTCNGCCTCGCTACTAGCGTAAATGCTCAAAACGCATCCAACACCACGAGTAA
TGCTGCTCCTGCTTTGCACGCTCAAAATGGTCAACTACTAAACGCCGGAGTCGTCGGTGC
TGCTGTTGGTGGTGCTTTGGCCTTTTTGATTGANGAAAAACGCCGCTTACTGCCACGATG
ATAATACCCTATTGACGTTTCTGAAAAGTATAATTTCTTTTCTCATCTTCCCCTTTGATA
TTCCATCTATAGGCCCAAGAGTCCTCGCCCGCCCCCTCCNCCCCTCCGNGAAGCAANNGG
AGGATAANTGTTGTTANTNTTAATTGATANACAAAAATGAGGGNGNGGGGGGGGCAGGAN
NGGGGGCGCCCACTAGTTTTNATNTATAATAAANTNAAAAAAAAAAAANAATTAANTCCN
GCANCCCCTCNCGGNAGAAGGGNANNNANAAAGGGCTTTCNCCCCCCCNAACNCCNCCCC
GGGGGGGGCGNGNNAATTNNTNCTTTGTTANNGTTTNNTGAAGNNANAAAAAAANTTAAA
AAGNCCNCNNAGNNNNANAAGTTANATAGNGAAANNAACNTNNCNTAAANCANTTANGCN
NNNTNGNNNNTAANNCNNATNTNNCTTNNNTAATAAGNNNAGANANNAGAGGNNCNNGNN
NNGTANAANNNNNNNNGNNCGACGNNANCNAACNNGCAACANNGNNNANCATTNNNNNGG
TTGAAACCCNGGA
Quality >S03036-01_L19.phd
29 19 5 3 5 6 3 4 5 5 8 7 6 5 5 7 5
5 10 10 10 5 7 7 9 5 8 7 8 6 6 10 9 10
6 9 8 9 13 10 12 21 18 16 12 9 9 8 12 13 16
19 15 21 17 20 9 19 25 15 10 10 14 16 21 18 28 27
14 25 23 35 26 21 27 16 18 20 14 12 23 12 16 18 16
12 16 16 6 9 9 10 12 39 19 35 35 35 44 23 33 16
10 22 24 15 11 14 23 10 23 30 35 39 31 22 32 35 19
29 16 16 16 22 22 19 14 11 10 18 7 12 12 14 32 26
14 20 20 25 32 13 13 19 18 16 23 22 11 22 24 23 46
35 46 31 20 25 34 41 19 47 46 60 47 40 19 46 35 19
32 48 42 60 42 53 60 35 28 36 45 60 19 19 27 52 32
46 53 53 60 53 53 47 45 42 45 35 45 53 39 29 42 20
26 39 35 28 42 39 45 53 32 45 45 45 53 45 46 46 53
53 48 28 53 53 41 53 53 27 27 37 18 36 44 34 53 35
44 53 47 39 21 20 42 18 17 27 24 19 36 34 27 29 27
20 20 19 10 11 26 46 18 18 13 13 10 16 23 11 11 10
16 6 16 20 23 28 44 42 27 28 35 40 32 23 53 27 13
18 29 12 19 23 15 18 10 27 35 24 28 36 13 27 28 34
31 42 33 16 34 42 40 31 19 12 24 34 24 24 35 26 32
24 14 10 9 18 18 22 24 23 16 23 33 24 27 24 27 18
20 20 11 17 9 10 24 19 21 40 22 22 14 40 23 18 24
33 19 28 14 34 34 20 33 14 16 9 28 8 18 10 19 13
14 16 11 14 10 23 14 10 10 15 10 11 9 10 18 14 11
14 14 14 14 14 9 14 10 7 11 12 10 10 8 10 8 11
7 14 10 9 8 11 11 8 6 6 9 10 9 9 9 11 8
9 9 7 9 9 11 12 8 13 14 8 6 8 7 9 10 12
9 10 10 9 13 11 9 6 9 9 10 10 20 34 24 10 9
14 9 24 9 6 9 6 8 14 12 18 24 28 22 14 8 9
11 11 9 6 6 8 9 11 9 14 11 11 9 13 9 9 16
11 9 9 11 16 27 9 6 9 8 6 9 12 14 11 9 9
9 9 9 6 9 6 11 19 53 19 19 11 22 18 17 14 12
16 6 11 9 9 10 9 9 6 11 9 9 6 8 10 8 7
9 9 9 8 8 12 6 14 9 12 6 19 10 11 8 9 10
8 6 11 7 6 6 11 6 11 10 8 11 9 9 8 14 14
9 9 6 8 8 14 12 13 11 9 6 9 11 10 7 10 9
6 9 9 9 9 16 20 11 18 40 24 22 12 11 14 6 9
7 6 11 9 8 9 6 6 9 7 9 10 14 10 9 8 8
9 6 5 11 14 23 9 6 6 9 8 8 13 11 6 5 10
7 9 16 42 35 46 35 21 5 10 10 22 14 37 40 8 10
7 11 9 6 9 7 7 10 9 5 5 5 5 11 6 9 11
9 8 9 10 6 10 11 11 10 6 11 12 23 12 5 7 11
10 9 5 13 5 5 8 6 14 11 9 9 5 14 11 6 11
10 13 6 10 8 6 7 6 5 9 6 10 5 5 5 6 8
10 8 5 5 11 6 5 8 8 5 11 5 5 10 9 10 5
6 7 15 9 10 10 17 8 18 5 6 6 13 8 15 6 18
5 5 21 8 11 8 10 5 5 9 6 5 9 5 5 5 5
9 8 9 6 12 10 5 5 5 5 5 6 5 5 11 5 5
10 9 19 9 9 5 5 14 6 11 7 11 11 8 5 5 9
9 11 10 19 15 7 6 9 5 7 7 12 6 10 10 9 8
6 6 6 5 5 9 9 11 11 10 9 11 8 9 11 9 6
8 11 14