S03036-01_L20
Seqid S03036-01_L20
Sequence >S03036-01_L20.phd
GNNNNNNNNNNNNNTGGCCCCNNANNATNAGGTNNCGANGAGGATAGGACGTCTNCCATG
GGTNTCCGATANTCCCTCTAGTCTTGNAAATCTCTTTCGNNAAAGATACCAGCCTAAGNG
ACGTTTTAGCTCATTCACTAACTTCAAACTGGCCACTGAATTGCCAGCCTGGTCTAAGTT
GCAAAAAATTTATGAATCTCAAGGTAAGACTTTGTCTGTCAAGCAAGAATTCCGAAGCGA
TGCCAATCGTTTTGAAAAAGTGAACGANACTTTCACCAACTATGATGGTTCCAAAATCTT
GTTCNNCTACTCAAAGAACTTGGTCAACGATGAAATCCTNGCTGCATTGATTGAACTGAC
CAAGGANGAAAACATCCCCGGCCCCCCCCTTCCCCTCGAGGGGAGGGGGGGAGGGAAGGA
ANAGTTTTAAAATGTACTGAAAAAAACGTAACAATGGGGNAGCNAGGATANAAAGACCAA
TGTGTGTAAATTTATATAAAANTGAAANNNAAAAAATAAAAAAATTAATCCCTTTNCCCC
CTTNCTCTNNCGGAAAAGAAGACAAGGGGGGGGTTTAANTTCCTTCCCCTCCCCCCCNAC
GGGGGGAGNAGGNGGGGGAAAAAAATTATTCTGCACATTTTTTNATAAAATAAGNAAAAA
AAAANAGAACTNNAATNNTTTTNCCNTTTATANNAAANGGAGGGNAGGAAGGTGGGGCAC
NTGNTNTCATNTNANNNAAGAAGAAGGGNNANAGGANNNTATAAATTTATTTTTGTTCTC
CGNCGCCTCGAAAGGGANCAAAAAAAAAAAAAAAAAAANAAAAAAAAAATNTTNTTCTNC
AATAAACACACANANCANAAGAGAGAGAGAAGAGGAGGGGAGGTGGNNNTTTNNNAAAAT
GAGCAGANNTAGAANTCAGCAACTNTNTTTANTNATCTCTTATACNN
Quality >S03036-01_L20.phd
8 6 6 6 7 5 6 5 7 6 6 5 5 5 12 21 24
18 16 13 14 5 7 10 6 6 9 9 5 9 19 12 9 6
6 11 10 9 7 9 9 9 9 10 13 18 14 13 9 28 11
10 10 15 6 9 10 9 24 16 20 13 10 7 9 10 19 10
16 12 12 7 11 9 10 10 15 26 12 12 10 22 23 19 23
11 6 8 19 18 16 29 8 9 18 17 19 10 9 6 6 9
10 10 12 11 21 11 25 20 16 11 19 15 13 9 10 10 7
9 9 9 9 10 19 18 28 14 10 11 14 14 20 39 42 12
13 14 33 14 20 23 40 37 27 25 31 19 31 30 12 9 40
39 41 37 31 37 32 19 25 23 19 37 50 31 44 53 53 53
53 20 14 34 19 15 14 12 26 40 44 46 40 23 40 40 40
37 37 53 33 29 32 14 25 14 23 32 24 32 24 27 35 60
30 44 47 24 53 24 53 53 53 40 19 28 16 32 18 32 16
18 13 19 14 11 22 42 18 27 24 24 19 10 9 11 9 9
14 16 13 27 27 22 8 11 9 14 9 13 10 14 19 19 27
25 10 11 9 10 9 27 19 20 11 8 11 6 12 16 42 37
27 24 16 28 24 14 19 20 37 19 19 11 18 13 14 9 25
28 27 22 10 10 13 9 14 41 13 12 19 19 24 47 7 6
10 9 21 33 11 35 24 10 9 8 12 18 14 14 23 23 11
28 32 40 23 12 9 14 29 14 20 14 19 34 19 15 10 6
9 21 28 24 22 13 33 18 17 33 18 26 25 14 18 14 22
35 9 14 11 18 28 14 16 19 6 8 9 10 13 9 9 11
17 11 11 9 12 9 12 9 19 13 9 14 12 19 14 10 14
9 19 9 11 11 9 12 12 11 11 11 13 8 12 11 11 8
14 13 9 9 11 9 12 10 10 10 11 9 11 6 10 11 19
17 16 10 8 10 9 11 11 10 18 13 18 22 10 13 9 12
13 10 9 10 15 9 9 11 9 9 11 10 14 19 25 9 9
6 11 9 9 6 8 9 10 11 8 12 6 9 14 9 9 11
14 10 14 11 11 14 9 11 10 11 18 12 11 9 21 18 11
13 21 9 10 9 18 9 14 6 9 11 11 11 9 6 6 6
19 25 14 11 10 12 9 11 14 9 9 24 11 9 10 10 9
10 9 9 9 12 12 9 10 6 10 9 10 9 10 10 14 6
9 10 10 14 6 6 11 9 9 10 10 11 11 9 8 9 10
9 9 14 9 13 14 9 18 14 9 11 9 10 12 11 9 9
6 9 14 9 8 8 9 9 9 14 11 14 11 19 25 22 13
9 11 6 11 10 17 9 14 16 24 9 9 10 6 11 14 11
6 13 19 32 11 14 21 16 9 9 10 10 10 9 11 10 9
10 9 12 9 10 8 11 11 14 12 24 17 9 12 7 10 28
28 12 11 18 9 18 11 10 6 10 9 11 9 19 11 29 14
11 6 10 11 14 9 9 11 6 6 11 11 11 6 6 10 11
13 9 6 13 9 6 11 9 13 10 10 9 6 7 23 11 11
6 9 9 9 12 10 9 6 9 10 10 15 13 12 9 8 10
11 12 9 13 9 9 6 9 13 6 9 7 11 9 8 9 6
8 6 11 6 6 6 8 11 8 10 10 10 9 9 11 11 10
7 7 9 6 11 9 12 9 6 6 6 11 10 12 13 19 13
19 16 12 11 16 18 9 17 17 13 13 8 13 12 14 13 16
7 10 10 8 14 11 11 14 11 11 10 12 10 16 14 7 10
8 11 23 14 17 18 20 18 15 14 28 35 28 33 25 14 28
15 12 5 13 21 16 21 27 30 24 17 16 13 9 6 12 13
7 11 8 16 10 6 8 14 16 12 21 10 16 13 14 14 25
13 16 7 10 7 13 8 7 10 13 11 19 9 20 16 14 14
10 15 9 14 13 14 8 27 16 10 10 15 17 13 17 14 8
14 11 7 7 7 11 12 11 7 7 7 14 12 18 13 18 14
18 8 14 14 14 13 6 7 14 17 15 13 10 7 13 11 8
11 11 11 10 9 12 6 12 6 14 12 10 9 6 10 7 14
9 9 14 15 14 17 11 13 19 11 7 6