S03036-01_L21
Seqid S03036-01_L21
Sequence >S03036-01_L21.phd
GNNNNNNNNNNNNNNNNNNNNCNNANNANAGNGGNGATTGNCGGCNNATCGGCCGAATTT
ATGAAGCAAAACAAGAAGCTTTTCTTTTCACTAACGTATATGATGCTTTTGCAAGCTTTC
CTTTTCCTTTTGGCTGGTTTTGCAGCTAAAATATCAGCATCAATGACAAACGAAACTAGC
GATAGACCTTTGGTCCACTTCACTCCCAACAAGGGTTGGATGAATGACCCAAATGGATTG
TGGTACGATGCAAAAGAAGGTAAATGGCATCTCTACTTTCAGTACAATCCAAATGACACT
GTTTGGGGTTTGCCACTCTTCTGGGGTCATGCTACTTCGGATGATTTGACTCACTGGCAA
GATGAACCTGTTGCTATCGCGCCCAAGCGTAAGGACTCTGGTGCTTATTCTGGTTCGATG
GTGATTGACTACAACAACACTAGTGGGTTTTTCAATGATACTATTGATCCAAGACAAAGA
TGCGTTGCGATTTGGACTTATAATACTCCAGAAAGTGAAGAGCAATACATNAGCTATTNC
CTTGANGGTGGTTACACTNNNACTGAATACTNNAAGAANCCTGGNTTAAATGNCCNNCTC
CCCNNNNNCCNGAGGTGCNGGGGNGNNGNGGGGAGNANNGTTTTTAATNANANANNGGAC
AACANACAAAAAGCAGGATNNAAGCAGNAAATTTTTTGCNCGGATGAANTGAAAANAGGN
ACCCCCCCCCCANNNTGGNAGCCCGNNGGGAAGGGAGAAAAACNATNNNTTNANTTAAAG
AAAANGAAAAAAAAGAGTTCANAGTNGNCNTGCTGGTNGAGTAAGGGCTGCGNNAATACT
AGGNNNGCNTGCNCAGCANNATTTGTTTTCAN
Quality >S03036-01_L21.phd
10 5 3 3 3 4 4 3 5 4 4 4 3 3 3 5 6
7 5 6 5 10 5 7 9 6 3 16 6 10 9 6 16 10
6 15 25 21 27 17 6 9 8 18 9 7 5 9 23 18 17
23 26 18 12 12 9 30 40 28 8 21 12 11 10 24 17 15
13 24 17 21 12 16 34 32 32 24 32 31 28 26 20 28 18
25 15 10 21 13 28 29 31 35 34 26 18 17 18 15 20 12
28 28 42 34 33 27 30 30 26 19 12 16 22 30 28 30 26
26 25 28 30 32 30 28 32 43 46 46 43 49 42 28 49 40
33 35 54 54 35 31 35 32 31 33 38 27 38 24 42 42 50
33 38 38 37 50 42 43 42 35 49 49 46 35 42 35 35 42
35 39 50 43 42 50 50 38 42 39 42 50 50 33 29 26 23
29 39 43 38 43 29 42 50 40 39 29 40 49 50 42 35 46
50 50 42 32 46 49 36 39 35 43 33 35 42 40 32 24 32
37 31 31 32 39 24 24 43 29 29 28 42 42 43 33 30 21
38 49 22 53 43 22 39 32 46 54 50 49 42 42 39 43 46
42 44 38 27 44 38 39 42 39 28 42 35 33 32 33 39 46
43 44 42 49 46 43 43 44 36 46 49 40 42 28 46 46 46
33 29 35 42 46 49 35 46 42 42 50 54 46 46 34 41 31
33 42 29 42 31 30 19 40 43 43 49 43 40 53 39 40 46
45 42 43 43 54 42 35 49 34 41 40 46 46 49 42 21 32
38 18 32 35 16 39 27 32 27 33 35 54 22 42 42 46 34
39 33 35 26 33 29 50 42 46 31 32 37 47 30 54 49 30
54 54 49 49 49 35 49 46 46 39 37 43 32 37 32 35 35
42 27 49 31 30 49 35 46 37 46 35 42 30 36 31 29 32
54 46 35 49 45 28 46 35 32 49 35 49 49 25 50 30 17
46 43 30 27 46 25 40 9 31 38 26 35 50 25 43 40 26
32 30 40 24 23 16 34 28 23 31 21 16 21 28 31 46 20
25 31 26 20 17 32 26 17 20 20 14 10 31 26 22 19 8
18 17 9 23 20 25 32 18 21 31 39 17 34 27 12 35 27
31 10 10 12 24 25 27 25 24 27 22 31 21 22 14 22 20
27 34 25 35 20 35 17 18 16 9 20 10 11 9 12 8 10
10 17 15 7 17 9 10 8 18 10 12 5 11 14 16 21 19
8 6 11 16 10 18 37 18 26 27 28 12 17 9 7 5 7
11 10 22 24 21 12 9 9 9 8 6 7 12 33 17 14 21
6 18 20 17 9 9 6 11 17 22 13 11 11 11 7 13 10
6 7 8 9 15 12 9 10 7 6 6 7 6 8 9 7 10
9 9 11 9 11 12 7 8 8 11 12 6 8 6 6 8 6
13 22 17 18 12 24 7 12 6 7 9 15 14 10 11 13 11
9 9 7 8 6 10 6 9 7 7 11 9 14 11 21 14 10
10 6 13 12 9 25 22 14 10 16 17 16 11 11 9 14 7
6 9 10 11 9 13 8 6 13 9 10 11 14 30 13 13 16
9 12 7 9 11 11 9 11 10 12 15 6 12 18 13 16 9
9 7 9 9 9 7 8 8 8 9 11 14 20 16 17 18 10
8 6 7 6 10 10 11 6 9 9 10 8 11 9 6 6 11
14 11 10 8 14 23 14 14 9 13 9 14 15 10 8 6 12
9 6 6 7 9 8 6 9 5 11 9 12 12 9 10 24 13
38 19 6 9 11 8 11 11 11 9 10 11 23 8 19 14 10
9 9 6 11 11 8 7 11 7 11 6 9 9 8 11 11 9
14 6 9 14 9 10 12 8 11 11 10 9 11 10 9 10 6
6 10 11 8 11 11 9 11 8 11 6 6 6 11 9 6 10
13 9 7 9 9 10 9 9 5 5 9 9 9 8 10 10 11
9 12 8 11 5