S03036-01_L22
Seqid S03036-01_L22
Sequence >S03036-01_L22.phd
NNNNNNNNNNNNNNNNNNGGNNCGNCNNNNAGGGNGATTGGCGGCCAAATCGGCCGAATT
TAAGCAACAAGAACATAAAAAATTGTTTTTGCTACATTGGTTTCACATAACATATTTCAA
CAAACATGCCATCAAATTTGAATATAGTGAAGGTTACAAAACCACAAGAAGAAAATAAGA
ATATTTTACACAAAAACACGAATGAACCCAATGAAATGGAACAATCGCAGACACAAGAAG
CAGTTACAGAAAATTTTACCGAAAACAGTAATCTCAGTGCAAATGAACATGCAGCTAGGA
GGGGTAGATTAAATTTGAAAACAGTTGATCACATAGAAACTTATCCAATAGTGCAAGAAA
CAGAAGAGATTGCAAAAAAGATTGCTCTAACGAGAATTATTTTAGCACAAACAAAGCCTA
GAATCGATAAAGTGGTAGTGTCACGTCCCGTTCAAGCCGTAGCACCAGTGGTCAATTTTT
TTGACAAGATGGCCAATTCGACTTTAAGTACAGTAGAGCGCGTTGTCCCTTCTTTGAAAA
CAAAAACTTATAAAAGATTAGGTGAGGAAATTGCACTTCCGTATACTTTGTCGAAAAAGT
ATGGNNNGCAGCTCAGGGATACGACAGCAAGAAATGGAGACAACTATGTTTACCAACCTG
TCCATNGNAGGTTGATGGAANNTTAGGAAGGNNNNTNNNGGAAAAATCATAGACACNNGG
GAAAGNGNTTTGATAANNNGGCCAACTTGAANCGGGNTNGNGAGGANNNAANAANATTNG
TCGATAAGGTAACGANAAGGTATATAGGANNAAGGTAAGGAAGGAGNAANCAAACNGAGC
NNNNNANGATNAAAGTGCCCACATCCCCCTTCANTCCACGTTANGGAGGAAGTTANAN
Quality >S03036-01_L22.phd
7 5 2 3 3 3 4 4 3 4 3 4 6 7 4 3 3
3 8 12 6 5 10 8 6 9 3 3 5 7 12 10 19 8
6 22 22 27 29 25 14 11 25 17 10 16 10 10 16 30 28
25 17 23 24 19 21 17 22 40 19 9 14 13 21 20 19 23
18 22 35 32 27 32 34 32 41 32 36 36 46 29 26 32 35
26 28 29 33 33 35 42 31 43 43 32 46 35 30 26 26 32
31 41 28 44 32 33 33 27 30 27 25 22 23 20 27 27 27
27 33 27 28 36 32 28 39 42 49 42 44 54 50 39 42 43
46 53 44 46 50 50 54 54 54 44 42 43 54 44 59 50 50
49 49 50 50 54 49 50 51 51 47 50 49 42 50 47 44 54
50 50 43 42 50 54 50 46 54 54 54 54 49 45 53 53 44
50 46 42 54 39 49 49 51 49 57 54 53 54 59 59 54 57
57 51 50 51 50 50 54 54 50 50 43 37 35 49 49 50 54
54 43 43 54 50 50 49 49 50 45 54 54 59 54 49 42 46
43 50 43 38 42 39 36 39 50 39 43 46 43 42 51 45 57
53 51 49 50 59 59 59 54 54 50 50 44 49 46 54 54 50
51 49 50 50 54 54 49 51 49 49 51 49 53 53 49 51 57
57 57 57 54 54 54 50 59 59 57 45 44 57 57 50 54 50
50 45 44 57 54 49 50 50 53 53 50 54 54 54 50 54 51
57 50 51 53 57 50 59 54 54 54 57 59 57 53 53 49 51
54 54 54 54 54 45 44 49 49 50 46 43 49 50 50 49 49
49 40 46 49 46 43 49 40 46 57 50 42 32 50 52 54 54
54 59 59 59 59 59 41 33 57 57 42 57 54 50 50 54 50
49 49 43 49 29 34 57 54 43 57 57 50 54 54 54 54 59
59 57 59 54 42 57 54 54 57 57 54 57 50 54 50 42 57
51 54 54 54 57 57 54 52 57 54 42 54 54 50 52 35 50
43 50 54 54 54 49 50 54 50 50 50 42 54 54 54 54 54
54 54 41 54 38 42 49 49 54 54 49 49 49 50 43 49 50
57 54 50 54 54 54 54 50 35 35 50 49 39 32 49 49 42
49 46 46 42 45 50 50 54 41 49 49 46 39 42 46 49 46
54 38 54 42 54 46 49 37 42 42 42 46 40 46 46 35 34
41 45 43 47 35 40 43 42 46 41 41 30 43 40 35 49 46
42 46 40 32 43 46 35 49 41 20 25 42 42 16 50 50 50
50 35 49 42 29 53 35 29 29 26 42 39 28 35 40 29 46
30 39 30 30 32 28 29 35 40 45 49 49 37 46 32 46 29
23 41 49 28 32 18 19 25 9 7 5 5 29 35 20 22 27
35 29 26 18 37 14 32 35 35 35 27 25 29 14 29 29 28
18 17 9 10 19 15 40 16 32 27 16 27 24 30 37 39 35
35 46 35 31 39 18 29 27 31 20 32 35 32 35 28 20 18
12 9 7 9 7 20 13 27 9 10 26 18 15 11 11 11 9
6 7 13 37 21 35 42 42 14 17 11 7 6 6 6 17 7
7 7 11 11 34 32 32 15 9 12 11 11 20 22 25 29 14
10 9 7 6 17 23 27 9 9 25 11 6 8 7 9 10 14
11 16 13 12 20 6 6 7 12 17 9 11 13 14 10 9 17
21 8 13 7 14 11 13 22 6 9 7 10 7 12 17 12 12
10 6 6 7 11 12 7 9 9 7 14 10 9 7 9 9 18
16 9 8 10 16 14 12 11 29 14 13 19 10 7 10 22 8
12 9 35 21 10 14 10 10 8 9 6 6 9 9 18 27 13
10 9 9 9 9 9 11 10 9 9 6 11 23 6 8 16 8
9 9 7 9 8 8 9 7 7 6 6 7 9 6 10 9 9
7 10 27 19 12 9 17 9 15 8 12 11 11 25 16 10 14
12 15 22 9 9 11 6 16 8 9 11 16 17 10 9 9 6
14 19 9 11 14 10 9 11 14 11 9 6 9 6