S03036-01_L23
Seqid S03036-01_L23
Sequence >S03036-01_L23.phd
GNNNNNNNNNNNNNNNNNNNGNNNGNNTCNANGGGNGATTGGCGGCCAAATCGGCCGAAT
TGACACAAAAGCGAATAGAAATAACCGATCACCACAGTTCCTCTTTAAAACATCTCAAAC
TCAGCATTAACTTTCAAATCAATCCAGTGAAAGTATGCTTGGTTTGACACTTCACTGCCA
TTTCCTCCTGCCTGCCTATCTGATGCTTTGCCACCACAAGAGTGTTTTCCCTATGGCTTA
ATCGCTTTTTTCCATTTATTTTTCTCTTTCCCCCTTTTAATAGAGGGAAGAGAGCAGAAC
ATACAAACATATCATTTTCTACGGTATAGCCTCCGCCTCCATCTTTAATAGTGACACTTC
CATCAAGGGAATAAAGAGGCTTCAAGTCAAGAACTAAGCAGTCCCAAAAAATACCCATAA
AACGAGTATAAACCATACTGTTATGTCTAAAGACACGCATGATGATGAACTGCCGAGCTA
CGAGGACGTAATCAAGGAAGAGGAGAGATTGCAATCTCAACCGCCACGACCACCAAGACC
AGCAGCTAACTTGGCGCAAGGGCACCAATCAAGACCCCACCAAAGGCCCTCGACAATGCC
AGCAACGTCCTCATCCCAAACATATGCTCATTCACACTCTTATACGCCTACAAGTTCCCA
ACCACGGCCTCCACCGAGGCCACAACAGAATCCTAGCTTGCCCTGGACATACCCTCCCAG
GTTTTACTGTTCCANGTGTGGAATACGGGTTACNAGTTGAANANTGGACGATCTTGCAAG
TCNGTGTNGGAGNNNNNGCANTCAAAAAACGTTGTTTTCTGCNNNNACGAATAAAAAAAA
CTATACAATGNNCGTGGANCCCAGGGATGGGANGGANANAAGGGN
Quality >S03036-01_L23.phd
9 4 3 3 3 2 3 2 3 3 3 3 4 5 5 5 5
5 3 5 8 7 5 7 9 7 7 9 8 3 12 5 9 31
31 7 24 18 13 34 32 16 9 33 33 17 23 15 15 18 31
28 28 22 25 35 35 34 21 32 38 32 21 29 29 29 30 36
40 40 35 42 28 36 41 36 49 46 44 49 31 31 52 52 49
49 40 32 32 42 30 33 27 23 28 30 38 35 35 42 42 54
50 44 37 24 33 33 36 42 39 36 32 29 29 28 27 35 42
35 42 44 44 43 50 54 50 50 54 49 42 43 60 54 41 47
54 54 60 54 54 54 54 60 45 41 54 50 50 45 60 50 54
59 59 45 57 50 54 49 63 58 60 60 60 58 54 54 59 54
60 63 63 58 63 58 49 43 33 47 54 63 58 60 59 54 54
54 54 58 60 57 58 63 51 51 58 58 60 58 58 47 63 51
58 58 58 60 49 60 49 50 54 58 58 49 54 54 54 54 50
59 60 63 58 60 60 59 54 60 49 50 57 57 52 57 57 60
52 57 60 44 52 46 42 40 40 57 60 60 52 57 52 52 63
63 63 63 63 63 63 60 63 63 63 59 60 60 54 54 60 60
60 58 60 60 54 50 57 60 59 57 54 54 54 59 60 49 60
49 59 59 58 54 54 60 59 63 54 54 60 60 59 54 59 59
54 54 59 63 63 51 50 54 57 57 54 59 57 57 57 53 43
53 54 53 43 51 57 49 51 54 57 54 54 54 54 57 59 54
42 54 54 59 54 50 54 54 54 54 59 54 54 50 49 50 50
54 54 54 50 44 46 46 43 46 57 53 51 53 50 34 51 57
59 57 53 49 57 54 59 54 54 54 50 59 59 54 54 51 54
51 54 54 54 54 57 54 57 51 49 54 59 59 54 50 57 57
57 54 54 54 59 54 54 50 54 59 59 54 54 54 59 54 54
54 49 49 49 54 49 49 45 43 47 59 59 59 54 59 59 54
54 46 57 54 54 54 59 54 54 54 52 59 59 50 54 49 54
59 54 44 49 54 35 42 54 54 49 49 54 54 49 49 49 43
43 49 54 41 54 34 43 26 49 42 36 49 50 46 49 49 50
35 46 46 53 42 49 43 52 36 52 52 42 52 31 31 36 49
50 43 46 52 52 50 52 49 52 52 49 40 49 52 47 41 50
35 42 35 46 43 49 46 49 49 49 49 35 49 36 52 49 37
46 49 52 37 49 36 49 49 49 50 31 30 49 35 42 46 53
41 32 28 35 33 23 45 42 46 30 43 46 49 21 46 41 40
40 40 40 39 34 41 40 45 27 21 32 46 49 35 42 30 36
52 34 49 34 40 29 40 49 30 23 31 30 28 32 28 30 36
36 49 30 20 19 16 19 36 32 36 36 41 46 50 43 49 29
29 41 40 32 41 36 36 46 49 36 40 49 42 46 32 42 32
40 26 25 30 37 21 40 33 41 37 26 25 26 15 20 18 31
36 36 31 40 28 45 37 15 24 19 28 14 17 21 30 35 15
30 25 36 12 32 36 25 28 35 33 26 26 23 26 27 14 26
21 23 23 21 21 17 26 13 14 30 27 30 30 35 33 21 20
33 27 15 19 19 10 38 12 35 15 16 27 29 30 42 16 35
20 20 11 7 19 16 28 18 50 33 27 21 11 18 20 23 40
35 26 26 15 9 4 13 17 12 19 19 12 14 7 9 5 9
10 31 25 16 9 9 8 15 25 30 28 21 16 11 8 10 16
6 19 10 19 9 7 17 15 15 8 7 5 6 5 4 8 12
14 7 20 15 16 26 29 13 9 13 14 10 9 16 12 11 8
13 11 9 11 11 9 7 6 6 6 14 14 11 11 12 21 10
18 12 18 18 28 29 18 12 12 15 9 14 27 19 14 21 10
6 6 10 24 21 18 9 9 6 9 19 12 14 12 9 11 19
12 25 30 13 15 7 12 10 8 6 8 6 14 9 15 16 12
7