S03036-01_L24
Seqid S03036-01_L24
Sequence >S03036-01_L24.phd
GNNNNNNNNNNTTNGTTNNNNNCNNNNNNNGGGCGATTGGCGGCCAAATCGGCCGAATTG
ATCATCAAACAAGCAACTACAAAAAAGCTTTACTGACAACTCACACAAATAACACAAAAA
ACAAAAACTTCAACAATGGTCGCCTTTTTAGAACTAACTTCTGACGTTTCTCAACCTTTT
GTCATCCCATCTCTTTCGCCAGTCTCTCAGCCAAGCTCAAGAAAGAACTCTGACGCAAAC
GTCGATGACCTGAATCTGGCTATTGCCAATGCCGCTCTTTTGGATGCCTCTGCTTCAAGC
CGCTCACACTCCAGAAAAAACTCTTTGTCTCTGTTGTAAGTGTTGTACACGAGAATTAAC
ACACTATTAGCATAAAAGACATTTGGCATCTTTACTTACTTGGGCAAGTAAGTCACGTAC
TTTTTTTTTTTTTCCGGAGCATTCATTGTCATTCTATCTGCACTTTCCCGCACTTACATT
CAATAACCTCGGATCGGGTCTCTTCTACGACAGAAACTTTTTGATATATACATATTTATG
CAATATAAATACTGAGAAAGTAAAAAAATTTAAAATATAAAATAATAAAAAAGTTACTAT
TACTNAAAAAAAAAAAAAAAAAAANAAAATAATAAAAANAAAAAAAAAAAAAGNAAAAAN
GNAAAAAAAAAAAAAANGNGTCCCGGCTATAAGGNCCAGCTTGANNATCAAAAGTGGCCC
CCAAAAGAGCTGGGGGGAAACTCAAAATTCCCCACAAATATAGAGCCGGAGAGCAAAAAA
TTGAAAAACGGGGGGGGCAATAGGAGGGACNCACGTCACATTAAATGGGGTGGCATAG
Quality >S03036-01_L24.phd
11 7 5 3 3 3 3 5 3 4 5 10 11 7 8 10 8
7 7 7 3 5 8 3 6 7 5 3 3 5 10 27 37 11
24 26 12 37 31 17 11 40 27 14 18 12 16 36 42 34 37
28 36 37 35 28 15 25 34 31 15 24 24 32 37 31 30 41
40 32 31 30 29 32 49 36 35 38 40 43 41 42 40 37 36
43 35 47 40 40 41 49 44 54 54 41 46 32 35 46 43 42
42 50 42 40 32 42 42 39 39 39 40 39 50 39 42 46 43
43 46 49 50 54 49 49 49 50 54 60 44 47 47 50 50 49
60 47 50 60 49 50 54 54 60 60 63 60 52 52 60 57 57
52 52 52 58 63 63 63 63 63 60 58 52 60 60 60 57 58
52 57 57 57 63 63 63 53 53 63 63 63 54 52 63 63 58
63 53 58 58 63 63 63 63 63 63 63 63 63 53 63 63 53
63 63 63 58 57 57 60 53 52 60 57 63 63 63 57 58 58
63 63 63 60 63 57 63 60 58 57 57 48 52 57 57 60 57
57 52 57 57 60 52 58 57 57 63 58 63 63 63 53 53 63
63 58 63 63 57 58 60 58 63 63 58 58 52 63 63 63 58
53 63 63 63 63 63 63 63 63 63 57 63 53 63 53 60 58
63 63 63 63 63 63 58 57 58 58 58 60 58 58 63 58 57
57 57 57 58 60 53 58 54 63 58 60 63 63 57 53 63 63
63 60 63 63 63 58 63 57 60 60 57 60 63 57 57 57 60
57 58 52 60 53 48 48 57 60 52 60 58 52 57 52 52 54
57 57 60 60 57 57 58 63 63 63 63 63 53 58 60 60 53
63 63 53 43 58 52 57 58 63 63 63 53 60 60 57 57 63
63 52 60 57 60 58 57 57 60 60 63 63 63 57 60 60 57
57 60 63 57 60 60 57 52 58 60 57 52 60 63 63 63 63
63 63 63 63 63 63 63 57 60 52 57 60 52 52 48 48 52
57 57 60 52 57 60 60 52 57 57 48 60 57 57 60 60 60
57 60 52 52 57 60 57 60 57 57 52 57 57 52 60 48 60
60 60 57 57 52 57 57 57 57 48 48 60 60 57 52 60 52
46 57 60 60 57 57 52 57 52 58 63 52 52 57 52 57 58
60 60 57 57 60 57 60 57 63 63 57 57 57 52 39 60 52
60 60 60 60 57 47 54 52 58 52 47 44 44 40 35 57 57
57 35 47 43 46 57 60 60 52 57 44 47 43 41 29 29 37
49 47 50 47 47 43 41 35 60 40 47 44 60 47 42 42 42
35 38 38 33 27 42 42 49 42 33 33 37 36 35 23 42 30
20 16 27 42 47 47 60 60 33 6 11 9 20 16 22 16 18
21 18 21 9 15 20 21 10 21 27 14 18 6 10 16 14 21
22 19 21 13 22 17 13 12 19 7 15 13 16 25 13 14 23
19 28 14 22 22 13 10 6 9 9 27 27 24 7 10 7 20
14 14 13 8 18 16 19 20 17 10 21 30 19 7 10 7 9
14 16 19 14 14 15 12 9 9 12 19 11 24 23 6 15 13
16 10 13 24 31 14 10 7 7 9 10 9 9 15 11 12 11
13 13 9 13 19 19 21 16 13 22 35 18 11 16 16 11 17
18 26 30 22 19 16 18 28 13 13 11 14 11 10 11 21 19
13 18 18 14 14 10 10 12 18 18 10 11 10 10 14 14 11
16 14 28 10 10 8 13 8 14 12 17 11 19 18 14 12 10
13 10 27 23 28 11 10 11 17 50 51 50 17 11 13 13 11
20 16 18 11 13 13 12 20 11 11 9 6 10 8 8 9 14
16 9 12 8 13 14 19 12 11 13 26 33 20 21 11 11 16
13 12 12 11 10