S03036-01_M02
Seqid S03036-01_M02
Sequence >S03036-01_M02.phd
NNNNNNNNNNNNNNNNNNGNNCNGNNNNNNGGNGATTGGCGGCCAATCGGCCGAATTGAG
ATTATTGCAAGTCATGCAAGCTAAAGTAAAACAAGCAATATCAGGAGCTCATAGATATAT
CATGCACACATCAGGTAGAAGATAGGAAATTATAGAAGATCTGAAGAAATTAGAAGAACT
AAGCTCGACTAGCCTAATAGGAAAATGGTGTCCCTTATTTAACCTGAGAAACCAATATTT
CGTAGTATCTTCTTTTTTTCTTCCATGGTAATGAGTCCAACAAACTTTGAGCTTCTAAAA
AATATAAACTCCAAATGAACCTGATCAGGACAAATGTTCTCTAGGGTAGTTAGATACAAA
ACCTTTCGGATGAGGGATTTCTTATCCTAGCTATTTAATGAAGCAAAATAAAGCTGTTTC
AAAAAGCTTAAGTGTTTGTACTTTTTTTTACCAGGTTAAAGAAACAGGAATAATTATTCG
TAGAATTGCAAAATTTTTTATTGACGTACTTGTTTCTATTTTTTGAATAGTCAGTTCTTC
GGAAGGCATTCAATAAGAGCCCAATATAAGGGTAAGGTGCACTTTTATACAAGCTGGCCA
AAAAAACCGGGAAATGGCAAAAGTTCGAACTATTGTTTCATAGGTACTATTAAATCCTTT
CANTTGGTAAAGAAAGGTGCTTGAATGACTTTGCAGACTATTTCTGNTTCCTACCGAATA
AATTAGGTGCGNTTTAACGCGGAGGGATGTTGTANATCATTGAANNNGGGNACTTGNTTT
ATTGAATACAGGATTAAAGANGAAATGGTACGGNANCATTTTTGAATTTTGGCNANAGTC
ACGATAAACNGTGGANGGCTGCATGNAANNGTGGAGAAGTGGCNNNNTGACCG
Quality >S03036-01_M02.phd
4 3 5 2 3 3 3 3 2 3 3 4 5 5 5 7 6
5 12 7 5 8 7 8 7 3 5 7 3 6 13 27 7 25
22 15 35 31 12 11 33 31 20 16 19 26 41 32 44 26 35
44 32 26 20 30 40 35 30 30 17 17 31 40 28 50 41 36
33 22 41 50 50 50 47 49 40 43 34 49 50 38 41 35 36
40 42 44 46 49 49 49 40 35 40 40 32 36 43 52 47 43
35 46 51 42 46 49 46 54 38 46 46 50 41 54 54 54 54
50 42 47 49 49 51 49 54 50 59 52 54 50 50 42 53 52
49 50 57 59 54 46 33 59 54 57 57 59 57 42 53 49 57
57 57 53 53 51 57 36 53 53 47 43 51 54 53 49 50 45
53 57 59 57 51 49 51 45 45 57 44 49 54 59 57 57 57
45 44 57 50 49 53 53 50 46 53 49 54 54 51 53 53 53
46 44 57 57 50 63 54 58 63 58 60 47 60 50 60 52 54
52 60 63 51 63 45 42 50 46 45 35 43 44 47 47 49 50
60 43 43 49 54 60 50 52 49 49 54 60 63 60 60 63 63
63 63 63 63 60 50 58 60 47 42 49 51 63 50 60 58 49
63 49 50 54 50 63 35 63 49 60 63 63 60 60 63 63 51
50 47 60 60 54 59 50 60 63 63 63 63 51 44 60 60 60
63 63 60 60 60 58 33 57 57 49 46 46 57 42 57 54 57
45 34 54 42 50 57 45 44 34 51 51 50 57 30 46 49 43
54 49 49 50 57 51 42 54 59 54 53 49 49 50 42 50 54
42 51 53 57 54 57 49 53 57 54 59 57 50 29 51 51 38
57 57 42 23 53 53 49 46 51 50 54 54 51 49 54 43 57
50 42 42 59 59 42 59 42 51 50 57 42 59 46 57 57 59
44 59 59 59 54 59 59 57 59 57 57 59 35 57 57 59 59
52 54 54 57 38 59 59 54 54 30 57 57 54 59 40 59 59
57 57 57 57 57 57 51 36 54 51 32 28 57 28 49 37 57
51 42 46 49 49 49 28 35 51 43 49 35 41 52 35 51 42
42 52 52 43 43 52 30 46 52 28 51 43 35 31 51 53 53
32 52 52 53 53 49 49 31 52 49 41 32 41 51 46 40 46
53 46 41 53 52 42 42 50 38 53 52 49 49 49 30 36 51
35 31 30 41 49 41 42 26 49 40 28 52 36 19 42 36 49
28 50 17 22 28 51 28 28 52 40 32 49 40 49 36 37 49
49 30 49 34 32 32 34 49 28 49 49 28 35 49 25 50 21
49 26 28 30 28 40 36 32 33 35 27 50 10 26 21 35 28
36 33 17 46 21 37 35 49 47 49 42 26 49 31 49 38 31
35 36 27 32 29 16 18 49 49 50 35 28 46 34 27 37 43
27 31 23 41 35 37 21 36 37 23 20 32 28 17 41 21 28
37 19 30 15 29 19 41 28 18 13 20 12 41 44 30 13 7
31 35 35 40 23 37 50 33 20 33 50 50 30 28 18 30 20
28 26 30 16 50 28 18 18 17 22 31 28 17 19 19 23 27
16 9 13 11 9 30 30 17 26 6 26 28 16 28 28 32 35
31 11 16 30 27 19 26 26 32 26 22 11 37 16 24 21 10
7 10 14 26 12 29 29 21 15 22 10 21 14 19 16 10 10
17 8 9 23 17 17 7 16 11 8 8 17 14 17 17 10 7
7 6 16 27 8 7 11 9 16 31 17 7 10 17 22 14 17
22 15 16 19 17 16 30 29 31 28 28 24 24 29 28 27 24
19 6 21 29 31 21 24 26 22 18 18 17 12 17 7 11 6
10 9 29 26 29 12 10 8 15 18 9 31 31 15 17 11 14
7 12 6 17 11 16 18 16 13 12 13 16 22 32 25 13 7
10 18 21 10 11 6 17 10 16 13 16 10 9 10 10 6 12
10 6 6 9 12 13 10 9 17 14 26 19 12 10 10 12 7
7 7 7 9 15 19 18 18 13