S03036-01_B06
Seqid S03036-01_B06
Sequence >S03036-01_B06.phd
NNNNNNNTTNNNTTNNNNGGANNCNNNNNAAANANNGATTGNNGGCCAAATCGGCCGAAT
TGGACTAAAAAACGATATTAAAATGTGGAAGGCCGTGATCAATGCTTGGAATGGAACCGA
GAGTCAAAGTAAGAATGTTTCAAATATTCAATCTTACAGTTTTGAAGACATGAAAAGAAT
CGTTGGAAAGCATGATCCTAATGTGGTTTTGGTAGATGTTAGAGAACCATCTGAGTACTC
GATTGTTCATATTCCTGCTTCCATCAATGTGCCATATAGATCGCACCCCGACGCGTTTGC
CTTAGATTTTTTAGACTTTGAGAAACAGATTGGCATCGGGAGAACCTGACAGTGCCAGGG
AGCTAATATTTTATTGTGCTGCAGGNAGGGAGGGGGCGANAANCGCCAAAACGGCTCATC
CNTCCAANGACGAANGAAACTTTAAAAGGNTTACATGAAACTNTTTTTNAATTGGTTTTT
TAAAAGNAGCNTTAACNACAGNAACTTNGACCTTCATGTATNAAAGAGGGGGGGAANCAG
GTGGGTGANNGNATAATATTTGTGGTTNTAGAAATGAATATATANACGNGGANGCCNNGG
TCTTCCCTNTTTATATNCAATTTNAGATTGNANGNAGANGNANTCGAAGTTNTTCCGNGC
CNCTACCTGCGTAGAAGATNGGGAGAGNGGGGAGGNGGACAGAGGANNATATCTTTTCTT
CTCTCTAGACAGAAAAGCTCAAGAGAGGGNNGGGGGNGNCGACTACTCCTCTTCTCTCAT
TTTAATGNGTGANCGAGAGGAAGGAGGGAGAGGAAGAGGATGTTNTCTCTNNCNCATTNT
TCATACGNTTAGATGANNGAGCGACATGGACGAAGGAAAGANNAGNNNNNNNNGNCAANG
ATNGGCGAGTGTTNGNAAAAAGNNAGACCGGNAANNNNNNGTGNNTTAGATGAANGNTNT
GGTATGNNNCTNNAANANNNNNNNAAANNNAAAANTCANTATTNACGNNAATTCAGANAT
TTTNTANNNNTANNNNNNNANNN
Quality >S03036-01_B06.phd
6 3 4 6 6 3 3 9 8 6 6 5 24 8 5 7 5
5 16 15 8 7 7 9 5 5 4 3 5 9 15 9 7 8
7 5 8 8 13 29 10 6 5 9 9 13 29 8 20 10 33
33 11 10 9 22 31 28 14 28 35 22 9 9 11 31 28 17
34 34 31 31 26 19 41 44 20 28 32 39 41 46 46 32 30
26 47 27 32 30 27 48 29 46 45 26 29 16 20 42 19 23
29 35 39 53 33 53 31 28 41 33 43 35 34 28 31 35 35
53 32 37 35 35 27 18 26 39 36 43 45 53 45 60 37 48
52 52 60 45 39 24 16 30 35 48 48 45 37 25 29 53 57
53 52 60 57 52 53 60 47 47 42 60 57 52 57 53 57 57
52 60 57 57 57 47 46 57 46 52 52 42 47 52 52 57 52
52 47 39 42 35 46 57 54 52 57 60 46 42 34 40 57 57
52 52 44 57 60 47 60 52 57 57 52 52 46 50 50 44 44
42 47 35 42 35 44 42 19 35 44 47 47 47 52 52 52 52
52 52 40 52 52 57 57 35 33 34 28 47 39 34 34 42 46
42 57 58 60 35 43 47 34 47 43 35 52 57 57 57 52 52
57 35 48 35 34 28 11 15 34 47 33 40 27 60 52 48 28
8 10 19 9 35 32 29 27 30 35 34 40 52 16 16 10 22
39 35 35 36 32 24 30 17 16 8 13 18 16 24 29 11 16
15 23 41 26 14 24 13 11 15 24 15 19 12 11 10 10 12
9 11 12 19 12 14 11 8 13 23 15 32 34 36 27 28 11
9 14 11 18 9 11 11 11 11 22 12 23 19 40 15 11 14
11 9 11 11 12 9 9 11 10 9 12 6 9 10 11 13 9
9 9 9 14 9 10 9 10 7 18 9 6 9 15 11 14 28
23 13 11 9 10 15 15 12 9 10 12 13 10 7 9 13 8
9 10 6 9 9 8 11 11 11 6 11 10 11 25 16 13 16
13 10 18 12 15 11 12 7 11 8 11 13 18 15 20 13 10
9 13 13 6 9 11 13 9 10 6 11 19 17 14 23 11 11
12 9 14 32 11 12 25 19 25 10 7 8 11 10 7 14 14
17 10 8 6 9 9 11 10 7 11 13 13 9 10 7 9 10
15 10 9 8 8 16 16 9 8 9 12 6 10 10 9 10 16
16 19 11 10 10 10 14 10 8 6 11 10 15 11 11 9 9
15 11 8 10 7 6 9 7 12 16 17 15 9 16 19 9 9
9 9 11 10 11 13 6 11 11 11 11 11 10 9 13 16 14
10 9 12 11 13 20 7 10 9 11 6 13 11 11 6 9 12
10 6 6 9 8 14 11 9 9 11 10 12 12 6 12 12 9
10 11 8 14 6 11 9 10 12 8 11 6 10 15 24 11 9
14 6 10 6 10 7 18 13 14 6 10 7 28 6 9 12 10
17 12 10 8 9 7 9 9 15 10 12 6 9 9 12 7 17
14 11 10 16 10 10 11 10 12 10 19 9 12 27 10 9 6
12 11 18 9 9 9 10 6 14 19 19 18 16 16 16 6 23
9 12 11 11 10 8 14 11 11 6 7 17 18 12 14 12 12
11 14 15 14 16 15 11 26 15 15 14 14 15 14 27 11 18
19 11 11 10 10 12 9 16 14 17 10 10 10 11 10 14 12
11 6 6 15 17 9 12 12 6 9 7 9 9 12 8 10 9
15 19 18 10 16 9 17 18 14 28 18 21 14 19 14 16 10
28 13 14 11 21 7 15 11 12 12 7 10 14 9 28 9 24
20 13 15 29 19 8 14 11 12 9 9 10 16 8 12 13 16
12 16 11 23 8 12 8 16 7 8 8 8 13 10 6 7 8
7 12 10 13 16 6 16 16 14 13 11 11 13 9 7 8 11
16 8 13 10 12 17 7 7 15 13 23 8 11 11 11 12 11
17 15 15 17 9 12 12 11 13 11 9 13 17 13 7 6 9
12 6 7 6 6 6 6 6 6 11 7 10 18 20 7 8 8
11 7 11 15 19 12 13 14 10 9 14 8 7 9 7 14 26
15 12 9 11 7 7 9 17 8 17 16 21 15 7 13 13 6
5 6 5 5 6 12 14 9 5 6 9 10 13 8 9 8 9
20 28 7 9 7 19 6 8 11 20 17 9 11 11 5 7 6
9 10 6 5 9 9 6 12 7 6 5 6 5 3 5 16 11
9 7 5 6 11 13 12 9 6 12 17 8 6 9 11 9 11
6 9 8 12 6 7 25 35 11 11 9 13 10 14 6 9 20
33 19 17 7 12 8 5 3 5 7 16 10 6 6 5 7 6
6 6 8 6 7 3