S03036-01_M06
Seqid S03036-01_M06
Sequence >S03036-01_M06.phd
NNNNNNNNNNNNNNNNNGNCNNNNNNNNNGGGCGATTGGCGGCCAATCGGCCGAATTGAT
ATAACAATTGAGAGAAAACTCTTAGCATAACATAACAAAAAGTCAACGAAAAATGCCTAT
CCCCGTTGGAAATACGAAAAACGATTTTGCAGCTTTACAAGCAAAACTAGATGCAGATGC
TGCCGAAATTGAGAAATGGTGGTCTGACTCACGTTGGAGTAAGACTAAGAGAAATTATTC
AGCCAGAGATATTGCTGTTAGACGTGGGACATTCCCACCAATCGAATACCCATCTTCGGT
CATGGCCAGAAAATTATTCAAGGTATTAGAGAAGCATCACAATGAGGGTACAGTCTCTAA
AACTTTCGGTGCCCTAGATCCTGTTCAGATTTCTCAAATGGCAAAATACTTAGACACAAT
CTATATTTCTGGTTGGCAGTGTTCATCAACTGCTTCCACCTCAAATGAACCTGGTCCAGA
CTTAGCTGATTATCCAATGGACACCGTTCCAAACAAAGTGGAACATTTGTTCAAGGCCCA
ATTGTTTCACGACAGAAAACNACTAGAGGCACGGTCAAAGGCNANTCTCAGGAAGAACTC
NATGAGATNGGTGCNCCAATTGANTACCTAACACCAATTGTCCNCTAATGCAGACGNAGG
CCAAGGCGGANCNCCGCAGGCTNCNAATTTNCCCANATGTAATNGNNCTGGTGTTGCGAN
ATNNTCCCGAAAAAAGAAAAGGGAGAGNGAAAANGGGNAAATTAGGATNAAGAACTTATA
AAAAGGGAGGGTGTNTGAAGGAATAGNGAAGANAANNGAAAGAGATAAAAGGGCAAGNAA
NNGCAAAGNGGCAAGTGGGCCGGTANAAAAAAGGGGNAANGCTTAAGTGAATAANNN
Quality >S03036-01_M06.phd
7 5 3 3 3 3 3 3 3 2 3 5 4 4 7 5 3
8 7 10 3 3 5 5 5 5 3 3 5 16 14 26 10 27
26 17 32 32 15 14 36 21 18 14 21 22 41 32 40 28 35
42 42 32 18 29 37 35 14 19 26 37 35 49 31 31 41 50
50 49 43 44 52 44 52 49 49 31 31 51 51 50 35 43 36
42 29 52 32 46 49 30 49 50 54 46 27 35 46 46 54 54
46 42 37 46 49 46 43 42 39 39 36 42 42 41 40 43 54
57 51 51 57 57 57 57 42 51 50 42 54 54 54 54 52 54
50 50 49 49 50 50 54 57 52 57 57 53 57 54 52 57 57
57 53 53 49 49 38 53 53 53 49 51 57 54 57 57 45 54
52 52 57 53 50 51 53 50 49 53 57 57 51 53 51 57 57
52 50 51 49 57 54 57 57 49 44 57 57 50 57 53 50 57
57 57 45 44 57 57 54 50 57 51 50 45 53 51 50 51 49
43 43 45 46 57 49 51 49 52 50 45 43 31 44 57 54 52
57 57 44 57 50 51 43 54 57 44 44 50 50 45 53 53 50
53 53 51 57 54 59 54 46 59 57 57 57 57 41 39 43 44
57 54 57 53 42 57 50 42 57 54 53 51 54 57 59 59 54
57 57 42 57 57 54 57 54 52 57 54 54 42 50 57 53 54
50 33 49 53 53 53 43 33 57 54 42 53 50 30 47 49 53
42 49 34 51 49 50 57 54 51 51 50 59 42 50 54 54 59
44 57 54 54 54 50 51 50 44 42 51 44 59 54 49 50 54
49 46 51 49 51 50 54 57 53 51 49 50 50 52 42 53 53
45 50 54 43 33 54 57 54 57 46 49 46 32 42 50 31 53
53 50 54 50 35 42 57 54 59 50 42 43 51 53 49 42 46
49 54 57 54 43 54 54 43 59 44 54 54 57 54 54 43 54
42 57 57 54 54 50 50 27 53 46 45 24 47 49 54 54 43
49 43 37 54 54 54 51 49 50 50 50 54 57 42 51 33 33
49 49 50 35 24 43 29 50 46 49 39 46 46 54 50 50 46
46 26 28 50 27 39 54 50 43 49 54 54 38 15 32 42 35
28 46 27 42 35 49 49 43 35 22 26 45 42 35 42 31 46
24 39 50 42 21 31 26 33 43 35 42 20 21 21 24 39 31
43 42 33 41 31 17 35 30 26 9 29 21 18 18 28 43 39
19 25 29 30 28 46 18 40 38 14 37 41 27 42 42 18 5
10 43 43 27 42 43 39 44 36 36 42 36 22 15 27 15 20
20 13 24 27 5 9 5 19 26 35 27 30 22 43 23 24 22
24 24 11 22 32 7 9 11 14 15 9 14 9 6 9 25 35
27 15 6 13 19 23 19 11 19 8 16 6 9 22 24 24 21
29 28 14 22 17 31 32 28 23 26 28 14 12 9 6 11 9
8 11 10 12 29 16 10 19 9 8 6 10 23 17 9 16 12
10 9 11 16 25 20 8 7 8 6 9 19 32 18 18 13 9
9 9 7 10 7 24 35 37 12 8 7 13 9 10 9 6 16
10 11 10 9 9 9 6 9 6 6 10 10 11 10 9 11 13
14 14 26 13 11 6 17 10 6 6 9 13 9 9 11 10 15
13 15 20 10 9 9 14 20 20 9 9 10 9 9 9 8 6
9 10 9 14 20 6 18 13 19 7 11 10 9 10 10 11 14
10 13 11 7 11 25 10 12 11 14 12 13 11 9 13 14 11
10 11 17 10 13 10 12 11 9 10 24 11 7 9 9 12 17
15 10 13 16 8 14 13 7 11 9 15 14 16 7 10 13 7
7 8 9 9 11 11 14 32 20 8 11 14 20 14 10 9 13
9 14 8 11 6 10 9 6 6 9 11 10 14 11 10 7 10
8 10 10 12 10 8 10 9 9 9 10 9 9 9 10 6 9
9 8 9 9 23 19 12 9 9 7 9 9 7 11 9 9 14
11 9 14 10 9 9 11 11 8 9 6 6 6