S03036-01_M08
Seqid S03036-01_M08
Sequence >S03036-01_M08.phd
NNNNNNNNNNNNNNNNNGNCCNNNNNAANNGGNGATTGGCGGCCAAATCGGCCGAATTGA
TACGGATAGTATACGATATTATCAATCTCATAAGAAAAATCTCTTTTGAATTTAACGGAG
GGATTATTCATTAGAAAGCGTTCTTACCATTCACTAGGAGCGAATCCGTGGAAGGTGTTT
TAACGTTGCCACGAAAAACAGCTCTACATCGTAATAAAAGATAACAATCAGTGCCCGTAA
GTTTCATTACTATTTTCTATTATTATCTGCAACTTTTTATTAGTTAGGTTTTTTTTGTTT
GTTTGTTTGTTTTCAATTGATTAATTTACAAGACAAAGAACCTTATATTTCGTGTTTTTC
ATTCTAAAGGAAAAAAAGCATAAAGAAGATTCCACACACTTTATTGTGATAGTTTTCAAA
GTAAAAAGTAATAGATTATGAGTACTCCTGCAAACTATACCCGTGTGCCCCTGTGCGAAC
CAGAGGAGCTGCGAGACGACATACAAAAAGAAAATGAATATGGTACACTAGATTCTCCGG
GGCATTTGTATCAAGTCAAGTNACGTCNNTGNNAGNNATANCTGGACCCGAANAAACTCA
NCTCNTTTTTANNTTATTGGGAACATAACTNGATTTTTTTTTTTTATNTTTTTTNNACNA
TGTATNCCAACTNTCGGGAGNACAGTAGGNAGAAACAAGTATGTANGNACATATTATCTN
ACAAAGATGNAAGNAAGCGGGGAGGGACAGAGGTGGGNTGGTGTGGGAANNAGGGGNGTG
GNCATTACTTATNAGAAACGACAAGAGGGCGAAGTNGATGAATANTAAAAGTAAGAGNNT
CCGAAACNTNCAGAACACCGGGCATGAAA
Quality >S03036-01_M08.phd
7 5 3 3 4 6 3 4 4 5 4 5 5 5 3 3 5
13 6 8 13 5 5 3 6 3 8 8 7 5 9 19 6 14
25 15 17 29 14 10 24 20 16 16 10 13 25 35 37 40 26
29 37 42 35 14 24 32 34 11 16 28 30 30 51 30 17 40
37 47 41 36 41 35 32 45 37 46 33 35 54 43 35 27 32
35 43 43 35 30 42 43 42 43 50 33 39 33 32 34 42 42
42 35 39 39 42 36 22 17 14 29 26 26 36 36 42 53 38
28 53 46 25 28 36 44 45 49 44 42 47 44 44 36 44 43
46 50 44 44 51 50 44 46 47 46 44 44 38 49 50 54 59
50 44 52 54 49 45 50 54 54 50 51 51 53 53 57 57 53
49 51 54 44 50 54 54 57 51 57 45 50 54 45 50 51 51
49 54 50 54 57 54 52 53 53 50 49 49 43 49 49 50 53
50 50 54 52 59 54 54 50 59 54 54 54 50 49 49 50 42
38 50 49 49 38 54 54 54 50 50 50 57 42 39 42 43 29
20 27 35 39 20 19 37 43 50 54 54 57 57 54 57 57 57
57 54 50 50 50 57 54 54 52 51 54 54 54 50 49 40 49
54 54 54 54 54 54 59 52 50 57 50 54 50 50 57 57 42
50 54 57 57 54 49 49 57 44 59 54 50 42 54 54 57 42
53 53 42 30 51 51 50 46 42 50 54 57 57 43 27 50 49
46 32 51 49 49 42 42 53 46 50 33 54 54 49 49 49 49
32 46 40 41 40 49 46 41 39 35 39 45 35 49 39 40 41
29 33 46 50 42 40 40 32 39 30 40 46 35 34 31 30 32
46 42 42 47 49 42 50 34 39 49 46 44 44 42 44 24 32
37 20 20 37 32 32 33 37 43 49 44 49 46 49 51 42 51
45 28 50 50 39 46 44 49 44 26 24 44 49 43 42 43 33
32 44 50 49 44 33 44 49 43 50 47 42 42 42 42 54 42
35 35 42 44 35 47 47 50 47 33 37 35 35 26 39 47 40
35 39 39 38 24 33 32 47 20 9 20 21 38 47 42 47 42
31 47 21 35 60 42 35 25 9 25 35 46 27 29 42 13 9
10 12 32 17 18 21 9 47 39 28 20 22 21 20 20 43 21
12 15 15 60 46 46 40 22 35 28 28 21 25 20 47 20 15
19 32 28 22 35 21 23 19 9 11 16 17 19 24 35 23 30
24 24 12 18 15 11 12 9 12 15 53 15 36 41 45 28 23
7 10 11 19 18 18 6 7 8 9 7 6 10 13 6 7 9
9 11 7 9 12 9 8 13 9 10 27 9 8 11 6 11 13
13 19 11 8 9 6 8 11 9 7 10 13 9 11 10 14 6
6 14 19 8 11 14 10 20 8 9 9 11 9 14 8 9 10
10 6 8 11 11 10 10 9 9 11 10 9 11 23 28 10 8
8 6 10 14 18 14 11 13 7 7 9 9 6 9 14 19 22
9 10 6 9 9 24 19 10 14 6 8 9 9 12 19 11 13
7 9 10 9 11 14 11 12 9 6 10 11 11 32 22 15 13
14 16 16 12 9 10 12 9 6 11 7 9 9 10 13 11 9
11 14 8 10 9 6 15 12 11 9 8 11 14 13 9 6 9
10 13 7 11 9 9 10 12 11 14 15 19 18 12 11 11 8
10 13 11 11 18 11 17 22 9 7 10 14 9 10 11 11 10
24 12 8 10 7 7 23 10 15 9 8 6 9 10 11 9 6
11 13 11 11 9 11 9 14 13 10 6 9 11 9 9 10 8
11 11 11 10 40 16 11 14 10 11 13 17 10 10 11 9 6
9 10 11 9 12 10 9 9 6 10 9 12 12 9 11 11 11
9 9 14 9 6 6 8 9 11 14 14 28 14 11 6 11 6
9 8 13 9 8 9 11 9 10 11 9 9 14 9 9 12 13
9 11