S03036-01_M11
Seqid S03036-01_M11
Sequence >S03036-01_M11.phd
NNNTNNNNNNTNNCCNCCCCANANNNNANNNGATTGGCGGCCAATCGGCCGAATTGTTGA
AAAAGGAGATCGTGTTGAGCTTTNNTTGACTAACGGCTTTCAAGACAATACTGCTACTTC
TCTACATTTCCATGGTCTTTTCCAGAATACGAGTTTGGGGAACCAGCTTCAAATGGATGG
TCCTTCTATGGTGACACAATGTCCCATCGTTCCGGGACAAACATACCTGTACAATTTCAC
TGTCCCAGAGCAGGTAGGAACGTTCTGGTACCATGCACACATGGGTGCCCAGTACGGTGA
CGGTATGAGGGGTGCATTTATCATCCACGATCCGGAGGAGCCCTTCGAATATGATCATGA
ACGAGTCATCACTCTATCGGACCATTATCACGAAAATTATAAAACGGTTACCAAAGAGTT
TCTGTCAAGATATAATCCAACCGGTGCTGAACCTATTCCTCAAANGATTCTTTTTAATAA
TACGNTGANTGTAACTTTAGATTNTACACCCGGNGAAACAAATATCATCAGGTTCTAGAA
ANTGGGGCTGGTAGTANNTNGGNATGTNAACNTAGAAGATAAAAACNGACCACCGATANC
AGNGGAACNNGGAGGGGGAGGAAGANTNNAAANGTAATCTAATTTAAGGGNCNAAAACAA
AAAAAAAGAGGGAGANGAAAACCGGANGAAANAATGACTAAGTAAATNANACCNTNTGNA
NACAAAGANACCAGCAANAAAANNGNGGAAGNCTTTAANGCANTAANNGTTATNNNGCAG
TGNAAANCTACGAANCANGACGAAGTNNAGNTAAGGGGGCAAGAATTAAAATAATTGAAA
CGNNCACCATNANNACANNNAAACAGACACCGAGNAGAGCGCAGTGCAATGAAAATAGTN
TANNNNNNNNNNN
Quality >S03036-01_M11.phd
5 5 6 10 5 4 4 2 4 5 8 5 5 8 8 7 8
8 8 9 9 5 8 6 3 3 7 12 5 5 5 9 11 9
15 17 9 9 9 12 11 12 8 8 26 32 31 24 26 21 17
18 10 20 42 16 34 26 22 17 13 19 24 22 20 24 16 11
18 12 28 28 27 29 35 42 49 40 46 31 40 17 8 6 6
18 39 9 31 23 33 27 30 32 21 21 35 46 46 43 38 31
29 39 34 33 24 26 29 30 33 39 54 43 44 50 44 50 54
54 54 27 23 12 26 9 27 49 45 60 44 31 51 58 60 50
59 54 60 60 50 47 37 25 43 63 52 54 51 58 60 63 63
63 47 63 63 63 63 57 52 52 52 57 52 60 57 58 52 57
57 52 57 57 57 57 52 52 57 52 60 57 57 57 63 63 52
57 63 63 63 63 63 52 57 57 60 57 57 60 63 53 60 60
52 52 57 58 57 60 52 57 60 57 57 54 48 57 57 57 57
60 57 60 57 52 60 57 57 52 57 60 57 60 54 57 57 52
57 52 58 63 63 63 63 53 57 52 58 52 57 57 52 58 57
60 52 58 58 52 52 52 58 63 58 58 63 63 60 52 52 52
52 60 63 57 57 57 60 63 57 63 63 63 58 58 58 52 63
58 60 63 63 57 52 58 63 58 58 48 52 52 63 60 52 52
63 63 45 63 63 53 53 58 52 57 53 60 57 60 57 58 52
60 57 53 57 48 48 53 57 57 57 52 57 52 42 57 52 53
57 60 60 48 48 60 53 53 45 44 45 45 57 45 44 37 30
32 60 45 35 44 47 58 57 57 57 60 54 57 60 52 57 57
52 57 57 57 52 53 52 29 37 53 52 52 57 52 53 44 53
53 57 53 27 41 52 57 57 60 60 57 53 53 53 43 53 52
52 57 52 37 53 52 57 23 53 36 60 53 37 23 34 53 47
40 29 22 53 41 53 53 53 52 53 33 44 35 35 53 43 53
35 44 42 53 46 42 13 12 11 9 29 25 38 53 44 27 16
18 13 10 9 9 6 9 9 17 14 19 19 19 35 27 34 34
23 19 14 19 19 18 13 8 6 8 18 11 6 10 42 13 19
41 21 24 34 18 11 13 35 44 9 5 11 13 29 12 16 23
17 11 14 6 18 11 11 11 9 9 9 9 12 11 16 14 9
10 14 11 11 24 12 11 13 10 11 19 36 12 8 7 10 10
18 23 23 16 20 28 11 14 11 15 12 14 6 6 10 7 11
10 6 9 13 10 14 6 12 13 18 6 9 11 9 14 10 16
33 16 11 12 14 18 13 11 6 8 11 8 11 10 9 12 10
11 11 12 6 10 8 10 6 9 12 14 11 11 6 6 11 9
14 14 10 9 15 11 14 11 10 10 9 14 12 7 9 6 6
15 12 16 6 9 9 11 9 9 8 10 9 11 10 9 10 12
10 9 9 9 7 8 7 9 16 16 12 10 18 19 20 11 15
10 11 10 10 9 11 14 14 9 9 11 8 6 12 11 12 18
11 8 10 11 14 10 6 9 16 10 9 6 19 14 14 11 9
8 10 19 18 9 11 36 9 10 9 6 8 6 18 9 10 6
10 7 10 14 6 10 6 9 8 9 11 9 10 9 7 11 13
10 21 10 17 10 10 6 9 11 11 9 6 6 14 6 14 8
9 9 8 6 10 9 12 11 16 14 7 9 9 10 6 9 11
11 6 6 8 9 9 11 8 7 7 7 9 13 15 10 9 9
7 8 9 9 6 9 9 9 8 11 9 9 6 9 11 7 10
11 10 9 12 11 8 8 6 6 10 14 6 9 11 9 14 11
19 12 11 10 9 9 9 11 14 11 8 8 14 9 12 8 22
12 9 9 8 23 14 22 11 9 6 6 11 10 9 11 9 9
6 9 6 6 9 14 8 6 6 6 11 11 8 10 8 8 9
10 10 11 8 17 9 12 6 11 11 9 11 8 9 11 10 10
10 16 8 11 9 9 9 10 9 19 9 10 9 8 9 6 10
11 6 6 6 6 5 5 5 6 5 5 5