S03036-01_A04
Seqid S03036-01_A04
Sequence >S03036-01_A04.phd
NNNNNNNNNNNTNTCNGGCCCTNNNNANNGGNGANTGGCGGCCAATCGGCCGAATTGAAG
GATAACAAACATCTTCTTTCGTTCGCTTCAAAATAACTACAAATTAAAAATGCAATTCTC
TACCGTCGCTTCTATCGCTGCTATTGCCGCTGTTGCCTCCGCCGCTTCTAACATTACCAC
TGCTACTGTCACAGAAGAATCTACCACTTTGGTCACTATCACTTCCTGTGAGGACCACGT
TTGTTCTGAAACAGTTTCCCCAGCTTTGGTTTCCACTGCTACCGTCACCGTAAATGACGT
TATCACTCAATACACCACCTGGTGTCCATTGCCAACCACTGAAGCACCAAAGAATACCAC
TTCTCCAGCTCCAACTGAAAAGCCAACCGAAAAGCCAACTGAAAAGCCAACTGAAAAGCC
AACCCAACAAGGTTCTAGCACTCAAACTGTTACCTCCTACACTGGTGCCGCTGTTAAGGC
TTTGCCAGCTGCCGGTGCTTTGTTGGCTGGTGCTGCCGCTTTATTGTTGTAATTTACTCA
ACCTTTTCTTTAATATNTTTTNAGAAAAATGGTTAAGTACTTTTCCGTCAATACAGCTTC
CACAAAAATAGTTTTATNTCNATTNGTAAGATATTCTGGTAATTTNTTNNTCTAAATCNT
NGANGCANACTTCNAACTNNANGNTTATTTNAATAANTTNATAGAAAGGTNANACACAGN
AGNAGAGANGTGTANGGGGTCAGGAAAGAGAGAAAAAAATAAANAANAATAAAAAATATA
AANGTGGGGNCNAATAGGGGGGAGTAAGTACCATGATTNTAAAGAGAAAGNCGAGTAAAA
ACCTNGGCTNGGAGGAANGGNGTTTNGANGCGGANGTGCCCAANAAAAAAANAAA
Quality >S03036-01_A04.phd
5 2 3 4 5 4 4 3 3 4 6 8 6 10 8 5 12
8 10 14 12 8 5 3 5 5 8 5 3 22 17 7 12 10
7 14 31 19 16 29 26 13 15 18 16 44 31 31 30 37 44
37 25 13 27 35 29 20 20 27 46 19 13 35 36 28 32 36
37 35 35 42 43 43 46 49 46 37 32 43 35 32 29 40 36
42 43 36 36 28 22 34 35 29 21 22 36 33 33 42 19 28
29 35 29 29 22 28 27 30 27 29 35 22 23 32 54 43 54
54 52 54 50 49 49 51 54 43 54 50 53 42 50 42 51 50
50 50 50 54 54 54 50 50 51 54 50 50 50 42 42 51 53
53 54 50 49 50 54 57 54 57 57 54 59 52 51 46 42 41
53 50 47 57 57 54 54 52 42 57 57 57 57 51 49 50 57
57 57 54 46 49 49 50 57 57 50 53 49 47 49 49 54 50
47 35 49 54 54 50 50 50 54 54 30 42 54 52 59 54 32
49 54 54 49 49 49 57 41 52 35 28 49 31 18 39 37 46
43 49 46 46 54 35 51 49 54 57 42 30 43 42 33 59 59
53 46 46 46 45 49 35 49 49 49 53 53 45 51 32 51 46
30 29 35 31 49 52 49 50 35 35 53 49 52 49 35 35 49
49 47 50 28 43 49 52 42 36 42 40 46 37 49 46 35 50
49 42 32 46 49 49 49 43 43 49 46 36 49 49 49 53 41
49 43 37 43 33 50 49 49 17 23 15 46 40 49 35 49 49
45 42 46 49 54 35 31 49 15 49 46 46 42 43 35 29 29
32 35 37 49 49 43 49 38 59 32 54 54 50 32 45 17 50
49 54 42 39 43 51 51 35 35 46 21 54 35 49 46 39 47
51 53 35 32 49 27 54 35 54 49 39 42 51 51 42 31 47
23 54 35 54 49 39 42 46 53 42 30 45 15 49 35 41 41
29 46 39 21 46 40 53 26 43 39 43 42 50 38 59 32 50
34 27 53 43 39 42 49 37 46 42 37 42 45 31 40 35 40
39 28 35 42 49 49 41 49 37 17 25 40 42 45 32 40 29
42 29 43 26 46 39 34 39 26 29 35 39 39 49 43 36 44
42 49 44 42 42 35 32 43 44 43 44 43 44 39 46 50 50
39 44 38 42 25 23 49 33 36 43 44 44 43 22 42 44 14
20 32 17 12 26 28 49 43 39 28 35 28 20 28 22 24 24
33 47 47 33 9 17 47 17 42 42 44 12 6 10 43 44 9
5 10 9 28 28 30 21 19 12 20 17 15 35 24 15 11 9
11 14 21 35 42 44 44 19 9 13 12 32 33 44 34 39 23
19 29 35 29 22 17 17 16 12 19 31 16 20 9 13 8 12
20 32 29 18 12 6 10 11 6 22 14 9 6 8 9 14 24
11 28 12 29 14 21 14 9 12 22 14 16 16 18 21 12 6
12 9 6 7 13 11 12 11 12 9 22 12 6 9 6 20 12
7 13 22 13 7 9 11 13 9 9 7 17 23 23 19 6 6
9 7 11 7 9 12 11 11 14 9 6 19 20 9 26 12 6
10 11 6 15 14 13 11 12 17 10 18 9 9 6 11 6 11
19 11 12 10 9 7 13 10 6 9 10 10 15 11 6 10 15
21 8 12 6 11 11 20 31 11 12 14 13 18 11 11 14 11
12 11 13 9 9 14 9 10 15 24 17 10 13 33 19 7 18
13 6 13 18 8 14 9 28 27 23 33 10 28 12 15 18 20
7 8 9 14 14 12 10 6 9 6 14 24 9 9 13 9 9
9 10 10 12 17 12 14 11 9 9 10 11 11 11 11 8 10
8 12 7 9 13 11 9 10 14 20 20 12 14 9 7 11 10
12 9 8 14 9 8 15 20 14 14 12 7 11 9 13 8 7
10 9 8 19 14 9 9 6 9 24 6 11 9 11 10 6 12
11 6 14 8 20 16 11 6 9 9 9 9 10 10 12 9 7
15 11 17 9 14 20 10 6 10 22 19