S03036-01_B07
Seqid S03036-01_B07
Sequence >S03036-01_B07.phd
GNNNNNNNNTTTNTCAGCCCANNNNANAAAGNNATTGGCGGCGNNTCGGCCGATTTGAAA
CTGTTTCAATATATACGTATCTTCTGCTTTCAGCTACATTTTTACTTCAGAGACATAACC
AGTCTTTTTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGTTAAAANNN
NNGTACCGGCCATAAGGGCCAGCTTGAGTATTCTATAGTGTCACCTAAATAGCTTGGCGT
AATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACA
TACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACAT
TAATTGNGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATT
AATGAATCGGCCAACGCNCGGGGANAGNCGGATTGNNAAAAGNGGGNTCCGCGAANCNTN
CTTCNATGGGGGGGGGGGGGTGGGGCGGTATGTTTTTANNATNGTANTCTTATAAATAAA
AGAANNGAANCGAGGNTNNGTAATAAGGTGGAAAAAAAGAAAGACAAAAAANACAANTGC
CCAGATGTCNCGGGGGNGNAAGANAATTTTTNTTTNTANATANNTTNNTTNAAAAAGGNA
GNGAGAGATTGNGNNAAGNTGACTAGAGAATGGNANNAGACACAAATACTTTAANTCTGN
NTGTNAGNAAGGGAAAGAANATTATATTCNTAATATANCTNNGNNCANGCCNCACANANA
GAAAGTCNANATGNTATGGAANAGNAGGCACTATTTANNNGNNAAGATAAGCTANNNACA
GTTNAGNGGGGANAANNNANANATTN
Quality >S03036-01_B07.phd
10 5 3 4 4 3 5 5 6 12 15 15 5 14 8 11 18
9 11 11 8 6 6 5 7 16 6 12 9 8 9 5 5 9
15 22 20 12 13 12 14 9 8 5 6 28 17 30 27 27 32
24 29 13 30 30 15 16 13 17 21 28 32 20 23 28 28 10
18 28 46 28 46 21 46 28 28 30 28 28 33 30 31 35 28
31 28 28 32 29 28 13 24 25 21 15 32 16 32 35 26 19
16 18 32 21 25 25 14 19 31 24 24 21 19 35 21 26 22
15 20 22 29 35 49 49 51 51 46 30 27 9 8 35 35 37
30 17 27 21 26 27 30 33 32 33 35 35 28 25 28 29 35
33 37 37 37 40 35 35 31 25 33 18 26 30 29 21 18 11
9 8 11 9 9 11 9 7 5 5 5 6 17 27 21 25 29
30 26 29 23 22 33 29 41 35 51 25 31 28 27 23 31 35
37 29 26 27 29 27 30 24 29 31 41 35 27 18 23 36 21
32 17 50 36 28 31 28 25 30 29 29 21 17 16 33 20 9
21 16 21 14 15 27 12 16 30 45 20 32 30 21 46 34 40
46 18 51 49 30 18 25 24 32 28 22 36 21 35 28 40 30
34 27 32 30 28 21 37 32 25 30 34 21 17 16 20 49 32
49 34 42 12 50 17 41 21 34 34 19 42 12 32 18 37 26
35 31 29 37 42 35 30 32 21 32 28 46 46 35 27 35 15
27 46 35 28 26 27 29 35 39 39 42 37 32 21 35 28 31
31 29 35 22 33 35 35 31 27 27 18 17 21 20 20 31 19
35 15 19 10 17 26 19 17 23 7 10 11 14 26 15 27 15
32 25 26 33 43 50 37 42 35 39 31 46 43 37 15 17 15
15 29 16 27 42 39 33 43 21 17 22 21 42 36 39 19 19
36 15 27 27 22 22 35 35 18 16 21 19 11 11 31 28 26
35 17 11 12 11 28 34 28 21 19 9 9 6 16 18 28 35
35 21 7 16 12 7 9 18 41 10 24 9 8 6 6 14 13
12 11 12 6 13 13 9 7 10 13 11 9 11 11 8 9 6
11 6 11 7 9 9 12 16 6 10 11 18 16 11 12 14 28
19 14 12 14 14 9 14 9 11 16 24 17 12 12 12 19 14
9 9 10 28 27 34 13 9 6 6 9 9 6 10 11 9 6
11 9 9 9 10 9 11 20 9 11 14 31 13 9 14 11 9
6 6 9 9 18 6 11 12 9 10 9 6 11 6 6 11 9
10 8 19 9 8 9 16 10 10 9 9 23 32 24 30 18 12
9 9 13 19 9 14 8 12 33 25 11 9 9 6 9 9 9
8 6 8 8 8 11 9 9 11 9 9 11 12 9 6 11 16
12 12 10 10 6 8 6 14 14 8 10 7 10 10 10 9 9
11 14 6 12 12 8 6 14 10 6 10 11 8 6 6 18 11
7 7 10 9 6 10 8 9 12 14 9 10 6 9 8 6 9
10 10 9 9 9 8 9 11 6 9 6 6 11 9 10 6 10
9 14 8 9 11 9 8 9 9 9 11 11 14 6 11 6 6
8 8 9 8 10 11 10 9 9 8 8 10 11 10 9 9 10
6 9 11 11 9 6 7 9 11 9 6 11 9 6 8 10 10
11 14 9 9 14 11 11 9 6 8 8 14 9 10 9 9 9
8 6 8 9 16 14 14 11 9 5 11 10 6 7 11 6 6
11 14 5 9 8 9 6 11 9 9 14 7 11 5 14 9 10
11 9 9 10 10 6 11 6 14 11 9 6 9 8 8 11 10
9 9 7 11 9 6 8 9 10 11 10 11 11 9 10 9 9
8 6 5 5 8 6 6 10 11 9 10 9 14 10 8 11 9
9 6 6 6 14 9 10 10 9 11 6 8 9 6 8 9 9
9 11 7 8 10 6 6 6 8 6 10 6 8 10 11 5