S03036-01_M13
Seqid S03036-01_M13
Sequence >S03036-01_M13.phd
NNNNNNNNNNNNNNNNNNNNNNNCGNNNNNNNGGCGATTGGCGGCCAATCGGCCGAATTG
ATATGAAAAACTCACCAAAAGGAGACCAATGGATTCCACAGCACTTAAGGTAGCTCTAGG
CTGTATTGCAATTCGTTTGGCTGTGAACAGCCTTTTTCCCTCTCTACAACAACAACTGGA
CCAGTCTGTAGAATTCTCAACTCCCGTAACTTCATTTAGGTCACTACAGGAAGGTATATA
CCTACTGCGGAACAACATCCAAGTATATAATCATGGGGTTGTTCACCATCCTCCAATTTT
GATTTTTTTTCTTTCCCTCTTTAATTCCGACAGGTTAATTTCCCTCATATACGCTTTAAT
TGATGGATTAATTGCGTATCAGCTGACAGAGGTAACAAAGGCTTTCAAAAACTTGAAACT
GAAAGTTTGGCTACCTGGACTTCTTTATGCCGTGAATCCTTTGACGCTTTTNTCGTGCAT
TAGTCGGGGATNNATCATATTCACAAATTTTGCCATTTCATCGTCATNGNANNGAATGAT
AGCTNAAGGAAACTTNCTNTTGTGCTGTGNAAAATAAAANNAATAAAAAANNTCAAANAA
NCNCCGCANCGGGNGGGGGGGGNGNGGGNNGATNNGTNTAANGGNGAAGGAANNAAAATN
AAAGCGAAANTGACNNAGNATTCATAATNAGGGGAAANAAAGGATAAAGNNNTCCNNNNC
CNTNAAAANNNAAGCCACTAANGAGNGGAGGNTGNGCNTANTAANGNANANAAAAAAGAG
NTAGTAGNNAATGGGAGGTNCNNGATAAGAGGNANAAAGTCNANANATACTTCNGNCAGG
AATCCGTANNANGCAAAGAGGAGAAAGAGGATCANAANAAGAAAAAN
Quality >S03036-01_M13.phd
7 4 5 2 2 2 3 3 2 2 3 3 6 6 6 5 5
5 5 5 3 3 5 8 10 7 5 7 5 3 5 7 16 14
12 26 25 17 24 28 14 12 33 22 11 15 15 11 34 27 28
24 33 27 17 17 15 21 24 15 11 23 16 20 40 28 31 30
32 31 29 37 30 31 28 24 30 40 42 40 31 49 35 35 24
19 28 16 20 23 31 26 26 27 49 49 38 18 40 26 20 30
30 35 35 29 28 29 30 43 33 35 35 33 42 35 42 35 42
43 35 37 54 35 35 35 46 50 37 35 35 41 45 45 46 49
51 49 50 42 43 54 49 50 42 42 54 43 50 54 54 51 49
49 53 53 46 51 51 50 57 50 50 50 42 50 54 50 49 38
38 40 49 50 49 50 49 43 43 45 44 44 50 50 50 52 57
57 57 50 45 43 46 50 57 57 49 51 51 53 51 53 53 53
46 45 43 46 50 50 54 43 46 42 43 54 50 50 50 54 54
49 49 44 50 60 60 54 49 46 44 44 47 50 40 40 47 47
47 47 50 60 44 60 47 49 51 60 49 51 63 49 60 49 60
60 60 57 57 52 57 57 57 52 57 58 57 60 57 57 52 63
52 63 63 63 60 63 57 63 63 57 63 63 57 52 63 52 60
57 57 57 60 52 52 57 59 63 60 60 57 52 52 63 60 60
60 60 60 57 60 57 60 52 60 60 57 57 57 60 58 52 60
60 52 53 57 57 57 58 60 57 57 60 60 52 57 57 52 60
52 52 60 60 60 52 46 47 60 47 47 57 47 60 47 47 37
35 37 37 37 42 42 37 60 57 52 31 46 57 59 52 60 57
48 52 57 57 57 60 45 26 53 52 35 33 45 35 35 52 46
48 48 57 57 57 57 52 57 57 52 53 60 60 60 52 57 58
63 53 57 60 53 53 57 53 57 57 53 60 57 53 53 53 45
53 53 38 53 45 46 53 32 53 41 45 53 57 37 30 53 53
53 57 53 43 44 45 52 45 35 35 14 20 12 27 46 41 30
27 28 27 25 21 9 9 12 23 23 28 11 6 9 23 24 18
27 25 18 23 18 30 14 19 13 23 26 10 8 12 19 7 6
8 19 13 34 10 24 18 20 23 34 18 11 8 12 21 27 27
37 23 22 14 13 18 35 31 18 32 13 14 10 9 16 38 12
7 9 6 11 6 6 14 9 20 11 9 9 9 9 14 12 10
7 18 11 25 14 14 16 41 11 9 9 6 9 8 6 9 30
12 8 10 26 11 9 13 28 6 9 24 10 11 11 10 13 19
31 6 5 9 11 10 13 13 19 16 14 11 6 6 9 9 11
9 11 7 9 9 7 9 6 14 11 14 8 11 6 8 9 11
9 6 14 12 9 9 11 9 11 10 7 11 6 12 9 10 6
6 9 9 9 6 6 8 10 7 9 10 9 6 8 8 6 9
9 12 9 14 16 9 6 7 9 13 14 11 11 6 12 9 14
11 10 11 10 9 9 6 9 11 9 9 6 6 11 9 7 11
9 9 9 9 14 9 11 11 7 37 22 15 13 10 10 9 9
6 11 14 9 9 9 12 11 11 12 8 11 6 6 6 9 11
9 6 6 6 6 10 12 6 9 7 9 11 9 9 7 6 6
8 9 9 9 8 13 9 11 9 11 5 11 9 19 6 8 10
18 10 8 6 9 8 6 10 8 6 8 11 6 8 9 9 7
11 6 8 6 12 6 9 8 10 9 10 11 10 9 8 6 8
9 9 8 10 10 6 6 9 9 10 9 14 14 11 11 10 9
6 14 6 6 11 9 9 14 9 11 8 8 14 7 19 7 8
8 9 10 10 9 6 11 6 9 7 9 9 9 9 8 8 9
7 10 7 8 10 10 9 9 9 9 9 11 10 8 9 6 6
10 6 10 9 8 9 9 8 9 14 11 9 9 10 9 8 11
10 14 9 9 11 11 14 6 9 9 6 10 10 9 9 9 14
14 9 6