S03036-01_M15
Seqid S03036-01_M15
Sequence >S03036-01_M15.phd
NNNNNNNNNNNNGGGNNNCNAANNNANNGGCGATNGNGCGGCCAATCGGCCGAATTGATC
ATCAAACAAGCAACTACAAAAAAGCNNTNNTGACAACTCACACAAATAACACAAAAAACA
AAAACTTCAACAATGGTCGCCTTTTTAGAACTAACTTCTGACGTTTCTCAACCTTTTGTC
ATCCCATCTCTTTCGCCAGTCTCTCAGCCAAGCTCAAGAAAGAACTCTGACGCAAACGTC
GATGACCTGAATCTGGCTATTGCCAATGCCGCTCTTTTGGATGCCTCTGCTTCAAGCCGC
TCACACTCCAGAAAAAACTCTTTGTCTCTGTTGTAAGTGTTGTACACGAGAATTAACACA
CTATTAGCATAAAAGACATTTGGCATCTTTACTTACTTGGGCAAGTAAGTCACGTACTTT
TTTTTTTTTTCCGGAGCATTCATTGTCATTCTATCTGCACTTTCCCGCNCTTACATTCAA
TAACCTCGGATCGGGTCTCTTCTACGACAGAAACTTTTTGATATATACATATTTATGCCA
ATATAAATACNGAGAAAGTAAAAAAGTTCNAATGTAAAATAATAAAAAAGTGACGATTAC
TATGNAANAAAAAAAANAAAAGNGATAGAAANCAATAAAAAAANGAAGAAAGAAAATCTN
AAGAAANAAGAAAAGAAGANANAAGAAATTAAAAAAAAAGGACAGAAAGAGGAAGAAAAA
AGGTGGGCGAGNCAANNCATACNGTGNGTGTCAGAAGNTNGTAGAGAANNGNNGGANATA
NNGAGAATATAGTATGTAAAGGAGANAAAGNANNACCANAAGTNNCGGCNANAACNAGGA
GGAGGAGAGNAAACAAAACCGACGCTACACGTTCGAGNGCGTGNNNNNAGAGGGGAAATA
TTCNANNNGN
Quality >S03036-01_M15.phd
6 3 2 6 6 4 3 2 2 2 5 7 11 15 10 6 5
6 8 5 10 8 5 5 3 8 3 3 10 8 9 10 9 9
6 8 5 16 12 34 21 13 12 12 10 29 29 35 30 29 30
23 20 22 30 31 24 11 21 28 30 33 28 15 26 27 28 20
24 32 35 35 40 38 41 40 46 32 37 37 40 37 42 18 10
6 7 16 5 5 8 49 31 37 19 31 49 46 31 30 31 25
37 31 31 32 35 32 35 43 35 46 38 38 43 46 46 49 46
35 46 46 43 42 45 31 27 21 12 14 18 42 49 49 50 43
49 50 42 50 54 54 50 49 49 44 49 51 43 43 50 50 44
44 49 49 49 49 43 41 29 30 42 49 49 50 54 50 54 54
54 54 54 54 49 50 54 51 51 50 50 49 49 49 49 50 54
54 50 54 53 53 53 57 57 53 43 46 57 51 49 49 63 50
49 50 54 60 45 50 60 54 50 51 49 49 49 49 50 60 60
54 59 50 44 47 47 47 43 41 42 57 57 57 57 57 63 43
43 63 43 33 41 43 45 41 60 63 63 63 63 46 47 57 63
63 52 57 60 52 60 53 52 53 46 60 60 63 57 58 58 52
57 59 60 60 60 60 63 48 43 32 48 46 58 57 57 52 60
63 57 63 52 43 48 60 59 59 58 52 63 57 57 59 60 54
59 60 52 57 52 63 60 60 60 57 52 52 60 60 60 60 60
63 60 57 57 57 60 63 59 63 63 60 59 59 60 57 53 57
57 52 53 53 43 43 25 39 33 53 52 53 53 43 43 43 60
60 60 60 52 58 57 57 63 57 57 57 60 59 57 57 60 60
60 52 53 57 52 63 53 57 53 53 53 57 60 53 60 57 57
57 53 57 57 57 60 60 60 53 53 35 42 60 53 53 53 57
53 60 53 53 52 60 53 53 53 53 53 53 53 53 60 60 57
52 57 60 60 47 27 30 47 53 38 9 35 25 37 43 28 27
53 42 41 25 28 27 44 47 35 25 42 23 27 25 27 25 20
37 34 38 23 17 27 23 23 14 7 13 18 27 24 34 20 35
27 15 15 23 46 45 53 45 53 24 34 31 39 15 16 35 21
18 25 30 18 20 19 19 20 27 18 39 29 16 35 34 32 16
35 32 27 27 36 60 47 52 31 24 35 18 24 16 16 14 9
14 13 15 20 36 42 41 22 22 16 16 14 19 12 11 19 19
35 42 37 18 16 19 6 15 35 25 32 35 43 35 31 9 32
47 31 9 12 8 9 12 8 6 12 14 11 9 19 11 13 28
22 13 10 19 11 9 12 9 13 11 14 29 16 11 10 12 11
11 17 16 22 24 17 15 13 11 6 19 10 6 9 13 33 17
19 12 15 9 6 9 12 16 16 9 6 9 12 13 23 14 18
12 15 7 8 11 14 9 13 15 12 14 12 11 12 7 12 11
11 18 11 12 9 11 13 19 12 10 11 11 9 7 9 17 18
9 11 14 7 10 11 16 11 28 11 20 10 19 14 10 10 6
11 6 12 21 16 10 10 16 9 12 9 8 20 11 16 13 12
16 20 9 14 11 8 11 17 16 14 19 14 18 14 8 11 14
12 11 8 13 16 10 11 10 19 17 22 20 13 11 18 13 12
6 11 16 18 7 7 8 13 8 16 9 6 12 8 16 7 14
8 13 9 11 8 9 9 13 10 6 9 7 9 12 11 10 11
15 20 18 5 6 10 7 6 18 10 10 6 13 13 10 6 6
10 18 19 13 13 14 21 16 20 17 19 8 14 12 10 11 16
12 11 16 13 17 19 7 10 13 13 10 5 14 6 7 11 8
12 15 6 15 16 9 9 6 7 10 11 12 26 6 9 7 10
10 9 5 9 15 18 26 10 12 9 15 8 19 19 31 14 7
27 15 11 14 20 8 12 12 12 15 14 16 13 13 8 11 14
10 16 12 14 8 8 13 14 9 12 7 25 12 16 11 18 6
7 6 6 7 18 16 8 12 10 8 18 15 12 13 11 14 12
8 8 7 9 7 7 7 9 6