S03036-01_M16
Seqid S03036-01_M16
Sequence >S03036-01_M16.phd
NNNNNNNNNNNNTTTNNGGGNNNNNNNNTNNGGGCGATTGGCGGCCAAATCGGCCGAATT
CCCATGGGGATCCGATGGAGCAAGTTTTCACTTAAGTTGGGGAGTAAGACTTTGAAAAAA
AATATTTCCAAGAAGACAAAAAAAAAAAACTCATTACAGAAGGCTAACTTATTCGATTGG
GATGATGCGGAAACTGCAAGCCTTTCGCATAAACCTCAAAGTAAGATAAAGATTCAAAGT
ATTGATAAATTCGATCTTGATGAAGAATCATCTTCTAAGAAGAAATTAGTGATCAAGCTG
AGTGAAAATGCGGACACCAAAAAAAACGATGCTCCTCTGGTGGAATATGTCACCGAAAAA
GAATATAATGAGGTACCTGTCGAGGAATTTGGAGATGCTTTACTTCGGGGTATGGGGTGG
GAAAGTGACTCCGAGCAAGATTCTAAAGGCGACATGACACAGAGTCGAAACAAGGACGTT
TCAAATGTTTCACAGATACATCCTGATGGACTGGGAATTGGTGCCAAGTTAAATAAGGCA
ATAAACGTGGAGGAGGCTTCATTTATGCCCGTCGTAAAAATCGATAAAATAACGGGCANT
AGANTGATGACGACAAAAANNNTAAGNCNTGAGAAAGTTTGANATAAATTTAAAGTGCTT
GTTATATNCANTAAGTTTTATGNATGGANCCCAAGNNGGGATTAANAGGAAAAAGCCCGG
AGGGGAANGNGGAAGGGAGAATGAAAGANAGATTTAGACTGCAATAAAGTCGGTTGAATT
NNTAATCTTGGATAATGTAGTNNCAANGTAGAGANNGAAAAGTCAAAATCACGTAGTANA
CGNAACANAAAGNGAGGCAGNTTGGNTAGAGNGNTTNNNNTNTTCNAGTTGAGAATG
Quality >S03036-01_M16.phd
7 5 5 3 3 3 2 2 2 2 4 4 11 12 8 5 5
10 9 9 3 3 5 6 5 6 3 6 9 7 7 15 26 21
16 22 32 13 30 20 11 14 44 27 23 26 14 25 26 45 37
40 31 45 44 42 32 19 35 40 26 31 27 25 36 44 43 36
41 16 16 34 43 50 45 37 47 46 30 36 49 42 38 49 42
46 46 35 43 20 35 49 44 41 41 36 37 37 41 40 49 49
42 36 37 37 36 36 35 24 43 54 49 43 41 49 49 49 49
54 54 47 49 54 50 49 49 49 39 34 50 49 50 49 50 42
34 50 54 50 43 46 49 49 50 54 54 49 47 42 59 52 50
53 53 57 57 50 54 57 54 50 53 50 50 50 49 42 49 53
51 57 52 54 50 50 50 54 51 51 50 39 30 49 42 42 54
54 50 52 57 57 43 41 57 53 53 54 57 57 54 54 54 57
53 51 50 54 59 54 54 54 54 52 54 54 50 43 54 50 50
50 54 54 54 57 54 54 50 46 50 45 44 49 54 54 49 49
49 49 49 50 49 49 44 49 50 50 50 57 57 57 54 57 54
54 57 49 51 44 44 57 57 54 54 54 44 36 50 50 49 54
57 50 54 50 49 49 44 53 49 50 51 49 44 44 57 50 50
54 57 44 50 54 54 54 59 57 54 57 57 38 54 51 49 53
53 49 43 50 42 49 49 42 42 38 42 42 42 57 53 57 53
47 51 54 50 49 49 42 49 49 50 49 42 40 50 50 50 49
46 49 46 46 39 32 46 39 42 40 49 39 47 49 49 47 40
40 42 42 46 49 43 42 50 46 49 49 50 59 54 49 53 54
42 38 46 49 53 57 54 54 50 46 43 47 35 32 53 51 52
57 54 54 43 27 42 43 50 49 46 50 50 54 57 59 54 57
53 51 42 42 33 50 57 54 57 44 57 57 57 57 49 49 47
42 54 34 30 43 50 49 43 50 33 49 36 50 42 42 21 59
54 49 45 47 51 49 57 38 43 43 21 43 49 49 49 40 42
49 49 43 49 30 46 43 28 30 20 18 29 39 43 49 46 32
32 44 54 49 44 34 21 15 43 44 43 29 22 43 35 35 39
46 46 50 39 39 49 39 43 43 43 46 49 44 30 46 39 30
28 44 42 43 43 45 32 20 17 43 30 28 36 38 31 15 30
24 14 18 30 30 44 19 8 18 20 14 11 22 14 27 27 21
15 33 35 35 38 18 25 33 17 13 14 30 11 44 47 19 9
9 14 21 16 20 36 26 35 16 9 16 29 32 31 23 15 39
44 17 19 35 35 32 27 34 36 30 27 32 30 19 36 22 21
14 8 10 7 9 9 10 9 5 13 27 20 9 11 20 16 23
37 26 22 30 27 32 11 6 7 7 29 39 21 14 7 9 6
12 18 15 9 13 9 16 14 24 19 14 13 16 6 9 13 10
12 42 29 34 13 10 19 10 18 10 8 9 16 20 14 8 11
18 18 10 14 7 9 10 6 11 9 9 9 10 13 13 19 11
24 22 6 9 15 12 10 8 7 10 28 11 9 10 11 7 6
9 14 14 8 14 11 8 8 7 9 14 12 15 9 10 10 8
10 10 22 9 14 9 11 11 14 10 10 12 9 6 11 6 20
24 14 18 16 17 12 9 11 10 8 9 9 9 9 11 14 11
6 9 13 10 9 10 19 23 9 11 11 20 14 9 13 9 8
9 12 12 12 10 11 10 11 10 11 10 11 14 8 9 6 6
11 10 12 8 8 11 17 11 15 12 8 9 11 10 14 11 9
8 14 6 7 8 11 11 7 11 9 10 9 14 9 10 6 6
12 8 9 8 12 9 9 10 9 9 11 10 9 12 9 9 9
9 9 12 11 14 7 9 11 14 6 9 8 10 11 6 9 10
11 11 7 11 9 10 14 9 11 8 6 11 9 13 11 7 9
9 11 10 11 6 8 6 12 10 6 6 6 6 11 7 10 11
8 6 10 12 8 11 9 9 9 11 10 9 8