S03036-01_M17
Seqid S03036-01_M17
Sequence >S03036-01_M17.phd
TNNNNNNNNTTCNANNCCCNNNANNAAAANAGANNNGCGGNTNNTCGGCCNATTGANATT
CTTTCNACCATAAGATAATANATATTATAACATTTTAGTACATAAAAGAGGCCCGAGAAA
ATAGATTTTAACTGGAATAATTTTTTGCAAGATGACAACAACCGTACCTAAAGTGTTTGC
ATTCCATGAATTTGCAGGAGTAGCTGAGGCAGTTGCCGATCATGTTATTCACGCACAAAA
CTCTGCCCTTAAGAAGGGTAAAGTCTCAAGGTCCACACAGATGTCCGGAACGAGCCTTAA
CGGAAATGGTAACACAGAATCCAAAACGATGGAGAGAGTAAATTCTGTAAGGAGTAATGC
CTCCAGCCGTGGTGGTAGTGAAGACGGCGCCACTAAGAAATTGAAAAAGGAGAAAGAAAG
GCGCTTCAAGATTGCGTTGTCNGGTGGTTCGTTAATCCAGGTGTTGCNNGGAGGANTGGT
GAAAANAGNCGACGTTCAATGGGGTAAATGGTACATTTACTTTGCTGATGAAANAATAGT
TTCCTCNANTNCAGTGAAAGCAATTAAAGACAAGGGATNAGACAAATCCCCCCATNGAAA
NGAGCCGCNGGGGAANGGAATAGAGGGNTTNTACATATTTTAANANTATTTGAAAAAAGA
AAAATATNNNTTGGTGNAACNCCGAATAAAACANGTAAAGGNNGNCCCGCACCCCACCNN
NAACCCGACCCGGCAGGNACGNGAGGAAATAGGTTAGGTTAANNNTNTTNNATCANTTGA
AGGAANTAAAATTGAAATGCNTANCTTGTNTTACNNACNAGAAGNAGNANNGAGGGGCCC
TGCTCGACCACCGGNACNAGAGCNGNNGGGNGGNGGAANGANAAAATGGTANNNAAATAA
AAGAN
Quality >S03036-01_M17.phd
10 2 5 3 5 5 4 5 5 9 11 9 7 9 6 7 11
21 12 6 5 3 9 7 5 8 8 14 11 6 8 8 10 7
7 7 9 9 12 12 6 9 5 6 17 19 20 18 13 13 7
10 9 17 12 9 7 16 13 35 35 21 36 27 13 7 22 21
13 25 29 35 31 32 30 12 34 38 37 19 6 10 11 13 32
40 28 25 12 14 30 11 27 29 29 20 27 22 21 15 24 11
15 8 12 14 13 27 35 42 42 26 35 42 39 33 23 29 21
13 15 14 14 9 24 31 43 34 31 23 30 43 43 44 42 44
42 39 28 46 35 43 43 43 43 43 45 47 40 41 44 45 28
51 44 47 31 42 44 24 42 60 57 52 52 35 52 40 52 35
43 40 60 57 52 52 63 63 52 57 57 57 63 57 54 42 57
52 52 57 57 60 57 52 57 42 52 57 48 48 48 60 47 46
42 47 48 20 52 57 60 57 60 57 57 57 52 52 52 52 47
42 42 60 60 36 35 42 60 40 40 47 60 57 45 53 45 53
57 58 57 60 57 53 48 60 60 52 57 48 30 43 43 48 43
45 57 52 60 53 60 48 48 60 57 57 52 53 63 57 63 57
60 58 45 57 60 57 52 57 63 52 60 60 60 43 44 53 41
53 45 45 52 57 60 48 60 58 44 43 43 43 53 41 53 43
32 48 53 48 48 43 48 47 48 35 48 53 53 45 60 43 41
52 60 48 43 48 48 44 57 60 52 45 52 45 52 53 53 47
35 35 35 43 47 40 48 47 37 26 32 58 40 40 41 40 43
32 41 16 34 43 48 43 47 57 57 60 48 48 60 53 48 60
40 35 27 35 47 37 19 19 22 19 35 37 48 40 35 48 27
21 20 43 40 63 19 53 53 26 20 40 47 42 48 33 43 43
26 43 32 32 48 36 29 22 31 21 35 22 34 26 24 40 43
30 19 19 26 29 20 21 27 32 28 39 34 40 35 28 9 6
8 32 13 19 9 9 19 42 14 16 16 31 23 25 22 14 9
9 10 14 34 19 28 20 22 7 6 9 8 10 28 22 11 7
10 28 11 10 19 11 11 11 10 7 10 10 7 11 13 42 29
39 34 40 26 20 42 35 30 29 12 18 11 12 15 10 11 13
12 9 17 12 16 18 19 23 16 10 14 10 9 11 14 9 21
22 11 9 16 21 9 7 16 9 14 16 11 14 9 10 16 16
9 8 7 9 7 10 6 14 10 23 14 11 13 14 9 11 9
10 12 9 14 10 9 9 11 11 11 16 9 9 11 9 9 9
6 9 18 12 10 13 17 26 10 9 10 10 13 11 12 11 9
7 8 14 10 15 6 9 10 10 10 9 14 12 6 9 9 12
9 10 13 6 9 10 11 8 9 18 18 12 9 15 9 7 11
9 6 9 9 9 10 11 9 12 9 27 18 9 9 6 9 6
9 16 11 11 11 10 9 15 9 11 15 20 12 25 11 28 10
10 13 20 9 6 6 6 10 9 8 10 10 13 6 9 21 13
6 11 10 9 16 11 12 24 18 11 11 8 18 7 23 26 11
22 21 10 9 7 6 9 7 9 9 14 11 14 9 19 19 12
9 9 9 10 7 7 6 9 10 11 10 11 13 10 10 14 9
9 9 10 12 16 14 6 8 9 8 7 19 10 11 23 18 19
9 9 9 9 11 14 11 9 9 10 9 9 9 9 7 6 6
11 6 10 14 6 6 8 8 8 9 7 34 9 10 12 11 9
8 14 10 6 16 13 15 14 13 12 8 9 10 11 11 9 10
8 6 9 10 6 10 10 9 10 10 6 11 9 11 9 7 6
27 8 6 11 8 13 15 9 7 14 9 6 8 7 5 9 11
8 10 9 11 8 10 11 9 10 10 11 9 10 11 10 9 14
11 11 11 11 6 10 9 6 8 9 11 13 10 5 20 6 6
27 24 9 6 16 9 6 9 8 8 10 6 10 9 6 8 9
19 11 11 10 11 8 12 6 6 6 9 16 10 11 19 31 9
9 18 20 6