S03036-01_M19
Seqid S03036-01_M19
Sequence >S03036-01_M19.phd
GNNNNNNNNNTNNNNNCNNCCTANNATAGGGCGATTGGCGGCCANTCGGCCGAATTGAGT
TATACAAATAACAAACAATAGAAAAATGTTTAGACAGTGTGCTAAAAGATATGCATCTTC
ATTACCCCCAAATGCTTTGAAACCCGCATTTGGCCCACCAGATAAAGTGGCAGCTCAAAA
ATTTAAAGAATCATTAATGGCTACTGAAAAGCATGCGAAGGACACATCTAATATGTGGGT
TAAAATCTCAGTTTGGGTCGCCCTACCAGCAATTGCTTTAACAGCTGTGAACACATACTT
TGTTGAAAAGGAGCATGCTGAGCATCGTGAACATTTGAAACATGTGCCAGACTCCGAATG
GCCAAGGGATTACGAATTTATGAATATCAGGTCTAAGCCTTTTTTCTGGGGTGACGGTGA
TAAGACATTATTCTGGAATCCTGTTGTCAACAGGCACATCGAGCACGACGATTAATTAAT
TGATTNAGTGAGAATAAACTTTTCGAAAAATTTTTATTTATGATAATTTTACTAATTCTT
ACTTATTTCCTTTATATTCTATTTNNNTCGANNGAAAAAAGAAAAAAAANAAAACCCCCT
CNCCCCACAACGGAGGGGGGGGGGGGGGGAGGAATTTCCCCCCCAATGAGGCNCGCAAGG
GNNTCAAAAGNNGACACNATTGTTNNGGGTTNCAAANAANAGAAGTTCACNCNAAAATAN
GAAGNNNAANCNGGCNGANNGNGGNAGGNNNGGGTTAAGATATTTCATGAGAGCGATAGG
GGANGNGACAGCAAAAACTCNGGGNCTAGGANCGTANAANAAANTAACCAGAGNCNAAAN
NAANNGGGGNCACGANCGGAAAAANGANANNT
Quality >S03036-01_M19.phd
8 5 4 5 3 2 3 5 4 6 16 6 4 6 7 6 8
5 3 9 13 9 8 5 5 10 8 15 9 12 19 13 12 16
12 21 23 10 12 21 26 9 15 9 7 15 22 34 30 27 17
24 17 10 27 26 19 14 14 19 32 16 29 21 30 14 21 18
36 18 23 25 24 34 41 27 28 42 32 36 32 32 26 21 20
15 26 36 27 46 40 28 40 21 41 12 28 25 35 35 42 26
31 28 29 31 26 26 26 21 27 27 29 28 38 54 42 46 46
38 33 42 30 37 46 43 21 35 46 26 29 38 43 43 33 43
43 46 39 39 41 32 43 43 34 44 54 59 54 44 44 46 43
30 58 43 60 35 49 50 47 45 42 60 60 43 46 42 43 41
47 54 47 50 47 47 32 30 40 41 43 43 43 52 60 57 52
60 44 47 40 58 39 52 63 43 43 43 43 41 43 42 43 44
44 53 48 60 60 48 57 57 57 52 57 57 47 52 57 52 60
46 42 35 57 42 60 52 52 46 60 37 40 32 48 42 63 63
48 43 43 60 57 57 57 63 57 57 57 54 60 63 63 48 48
48 43 60 52 52 52 60 43 43 53 52 58 52 60 63 60 60
57 60 63 52 60 58 53 48 63 57 52 60 60 53 60 57 52
58 60 60 47 63 53 63 57 63 63 53 33 48 57 63 60 52
57 48 48 60 63 57 53 52 52 52 63 52 48 57 63 60 63
57 52 58 60 53 58 52 57 57 60 57 57 60 53 52 57 60
57 53 52 52 57 57 53 43 35 57 52 53 53 44 44 35 37
29 29 53 53 29 24 29 39 37 53 52 48 28 53 57 52 57
58 60 57 63 53 39 53 45 52 53 53 34 37 34 36 60 60
44 44 53 47 53 36 57 52 53 57 60 57 60 57 53 53 52
53 53 44 34 37 26 37 39 60 26 53 37 35 35 45 45 53
28 39 53 53 27 53 41 34 35 43 29 9 10 27 53 37 53
57 18 53 53 19 52 35 43 26 27 53 57 23 41 44 22 39
24 20 20 37 18 34 22 23 31 29 17 37 34 29 32 39 53
45 35 27 27 22 8 22 13 15 7 18 19 18 29 18 32 27
27 18 20 30 24 20 21 29 24 34 20 15 19 22 15 17 27
19 21 34 43 43 23 37 28 20 23 30 9 13 10 12 27 19
27 29 13 18 11 8 9 20 20 30 39 32 30 29 29 25 27
21 25 26 27 15 9 18 30 30 16 17 42 31 14 14 10 18
47 19 12 7 5 7 9 9 11 15 6 6 19 22 13 10 20
9 9 10 11 11 16 29 9 14 11 11 7 10 10 18 15 10
13 24 10 12 11 8 6 14 10 13 11 9 9 13 12 11 9
11 11 9 9 11 12 18 15 11 9 8 9 10 19 16 11 11
11 15 11 10 8 9 11 8 8 9 13 12 19 18 9 9 9
9 9 10 13 11 10 6 8 11 8 18 14 10 13 11 7 6
13 11 17 19 13 9 17 7 6 10 9 14 9 10 6 12 14
13 14 13 9 7 6 13 8 9 14 9 6 15 8 11 8 7
28 9 6 8 10 22 14 10 11 10 9 11 9 7 9 6 13
18 14 19 9 10 6 11 9 10 11 6 6 6 11 10 7 10
6 9 24 14 6 13 10 7 5 9 6 10 9 7 11 9 11
5 5 6 11 9 9 9 13 11 9 11 9 11 13 11 9 10
9 13 10 16 12 18 19 15 11 11 9 9 8 8 9 9 9
9 6 10 6 11 11 10 9 9 9 16 8 12 19 8 9 11
8 6 13 13 19 7 8 8 22 9 23 11 7 24 10 9 11
6 19 9 7 11 11 12 6 8 11 24 13 11 9 8 11 9
6 10 6 11 9 9 6 6 9 19 6 6 8 10 11 8 6
14 11 9 22 10 6 9 11 11 11 10 11 9 10 7 10 9
6 9 6 6 8