S03036-01_M23
Seqid S03036-01_M23
Sequence >S03036-01_M23.phd
GNNNNNNNNNNNNNNNNNNNCNNNCNATNGGNGATTGGCGGCCAATCGGCCGAATTGACA
ATGAGGGCAGCAGGTTTAGTTGATATTGCCACCGTCCTAAGCACAAGTGCCTACCTAATA
GAATCAAAGAACCCAAAGAGCGATAAGAGTTTGATTGCTACTATCAAATCAAGAATTGAA
GGTGTCATGACCGCTCAAAGGTTCGTTTCATGTATTTATAACGCACCTGAAGACAAGCTG
CCTGAACTGTTGAAGGTGACGCCTGGCCGTAGAGCACCAACCATTTCCAAAATTGACGAT
GAAGGATGGGTTGCTGTTAGTTCCATGATTGAGAGAAAAACGAAGGGTGTTGTTTTAGAT
GAATTGAAAAGACTCGGCGCATCTGATATCATGGTTTTCGAAATTTCTAATTGTCGTGTA
TAAGATAGAACAGAAAAAGGGAAGCCAAATCCCGATTAATTTTGTAATTTTTTATGNGCA
ATAATTTGATAGAGTTCTATCTTTTTTTTTAGAACAAAGNGAAGNNAAAAAAAGAGGAAA
AATCNACNGNAGCGGGCCATAAANGGNNNAAANAGAATAACATCAGNGTCACCNNNCANG
CCANNAGANNNNGGGGGGGNAGGTGTTCTTGGTNNNNTNCNTTTAGTAGGAGAGAATGGN
AANAAAAGAAAGCGAANGTGTGNGGGTAAAAGATANAAGNNGCCAAACCAACTCNNTGCG
GCNNGGGGAGGNNGGGGANNNACCNTGGTTTTCNNCTTTNTNAATGGGTGGGCCAAGAGG
NANNTAGGTGTGGCAAAGNATTGGANNTTTNAAAGAGCGGANNNTNTAAGACANNCANNN
ANAAGGGANTGGTNGNANGGNN
Quality >S03036-01_M23.phd
8 5 3 3 3 2 5 6 6 5 4 4 5 5 5 6 5
3 3 3 8 7 5 5 9 5 8 9 6 13 13 6 16 15
9 22 27 14 14 33 29 13 12 9 9 35 29 36 25 31 30
16 22 9 22 31 28 11 21 16 15 30 41 28 21 35 21 31
26 27 34 37 31 40 35 49 35 37 40 37 34 32 30 26 20
25 37 30 35 31 14 50 36 23 18 35 46 32 32 31 33 32
30 28 17 15 21 47 46 35 35 30 35 35 32 31 41 41 36
35 35 49 35 42 35 25 31 37 28 50 42 42 40 33 46 50
54 42 42 50 49 49 50 49 49 53 51 53 51 57 53 53 47
51 50 53 53 51 45 49 57 42 44 54 54 50 49 51 50 50
54 54 54 50 50 44 53 53 50 49 49 53 57 63 58 60 60
51 58 44 45 63 63 63 63 49 49 49 58 58 51 49 54 50
50 47 49 47 49 47 60 49 50 49 50 60 50 50 54 57 60
57 52 57 60 52 57 44 52 40 34 42 52 57 52 46 60 57
57 60 57 57 44 52 58 57 52 63 63 63 57 57 52 57 52
52 57 58 52 52 52 63 63 58 63 58 57 60 60 54 58 44
63 57 60 52 52 63 57 63 63 63 54 58 63 63 63 52 57
63 63 63 58 63 60 57 52 57 58 54 60 63 60 52 63 52
52 63 63 63 57 63 58 52 58 63 46 45 52 57 58 58 60
52 52 60 63 63 52 57 57 52 47 57 57 57 60 60 47 44
52 42 47 44 52 57 57 52 57 40 40 44 42 40 47 35 35
39 52 52 57 57 60 54 63 57 52 57 60 60 47 52 52 60
52 30 40 52 35 57 42 44 57 57 57 52 47 57 54 52 46
57 63 58 57 60 57 57 57 60 52 52 57 47 60 60 57 52
60 57 52 57 57 57 57 46 47 57 47 30 46 19 39 29 52
42 42 47 57 44 52 52 35 60 46 57 57 57 33 57 52 57
47 35 39 39 47 42 42 47 60 57 40 28 40 25 29 21 22
22 16 14 18 23 14 12 19 22 29 22 22 35 22 12 9 9
7 19 11 11 22 11 12 16 8 18 17 35 32 32 24 13 34
9 15 40 22 35 29 34 14 28 35 9 9 11 11 13 14 13
14 9 9 9 13 15 10 13 10 7 9 16 11 10 6 6 9
11 10 10 10 10 8 9 9 8 10 10 9 11 13 11 11 12
6 11 9 6 9 6 13 9 10 20 20 10 19 12 10 13 13
12 9 6 12 16 6 6 6 9 10 10 6 9 9 9 18 19
9 10 16 12 10 13 10 9 7 9 10 18 9 20 12 6 6
6 12 9 6 10 10 10 10 7 7 9 9 10 6 7 6 6
18 18 20 16 22 19 11 6 19 39 11 9 11 14 9 10 10
11 9 11 11 7 6 7 6 10 6 10 7 12 10 19 11 14
10 10 9 9 13 9 10 9 16 14 10 20 13 6 10 11 7
9 12 26 23 9 11 11 9 9 12 18 8 9 7 9 9 9
11 17 6 11 9 14 10 23 26 10 9 9 9 9 9 6 11
9 13 6 6 11 11 8 10 11 13 9 8 9 10 11 9 9
6 6 9 10 10 11 11 10 6 6 13 11 14 10 11 10 11
6 6 8 16 14 18 9 6 6 6 11 11 10 7 8 9 10
9 9 14 23 10 6 6 8 8 9 13 6 8 7 10 9 10
10 9 9 9 10 11 11 9 10 10 10 8 10 9 9 7 10
6 6 14 9 16 9 8 19 9 9 10 8 11 8 8 14 6
9 9 10 9 12 8 6 6 8 10 8 5 14 16 10 9 9
9 11 11 8 10 6 5 6 9 6 8 10 9 9 11 8 10
5 5 10 10 5 6 5 8 6 10 9 14 9 9 8 6 8
8 8 10 5 9 5 11 5 9 8 6 6