S03036-01_N01
Seqid S03036-01_N01
Sequence >S03036-01_N01.phd
NNNNNNNNNNNNNNNNNNNANNTNNGGGCGATTGGCGGCCAATCGGCCGAATTGACTGCC
ACTGGCTCCACCAAAGCTTGGGCTTGGGTTTATATGATCTCGTACTGGTTCGGTTCCGTT
TCTCCAGGTTCCACCAACCAAAGTGATTACTCGAGATTTGGTTCCTCCAATTGGGCTATC
TGGGCCGGTACCATCTGTGCATTGTTGATTCCAACCACTTTAATTCCAGTTTTTGGTGTT
ATTGGTGCCTCCACCTGTGACAAACTATACGGTGAACAATATTGGATGCCTATGGATATC
TTCAACCATTGGTTGACAACTAACTATTCTGCAGGTGCTCGTGCCGGTGCGTTCTTCTGT
GGTCTACTGTGGGTTTGCCAGTGGTATGGATTTGGCCGGTTTATTACCCAAGTACGTCGA
CATCAAGAGAGGCGCCCTTTTTGGCGCATGCGTCTCCTGGGCTTGTTTGCCATGGAACTT
CTACAACTCTTCTTCTACTTTCTTGACTGTCATGAGTTCTTTCGGTGTTGTCATGACTCC
TATCATTTCTGTCATGATTTGCGATAACTTCTTGATCAGAAAAAGACAATACTCCATCAC
TAATGCCTTTATCCTCAAGGGTGAATACTATTTCACTANGGGTNTTAACTGGGANAGCTA
TTGNTGCCTTGGTTTGTGGTATGACCCCCGGTCTACCTNGGANCNCTTNGGGAANTCNAC
CANTAACTNNTTTCNACAACACTNGNATTGTCNANTTNCTNTTACNGNGACTNCNTNCTT
CTCGTNTNTGATCNNNNTTATCAAGNNCTGNGAGCNNATGCATTNTCTTGCCATCNNN
Quality >S03036-01_N01.phd
5 3 2 2 3 3 2 2 4 4 6 5 3 3 3 5 7
3 5 9 5 5 8 5 7 10 26 32 13 32 24 15 32 46
20 14 42 24 15 15 30 31 37 43 46 24 34 43 41 27 11
20 47 41 15 16 50 47 43 15 22 33 50 44 43 49 49 50
24 16 42 29 28 50 52 50 52 53 52 52 49 42 43 52 49
50 49 50 49 49 50 35 54 43 44 49 42 39 54 59 57 50
47 49 42 46 45 51 54 54 54 50 51 54 54 54 57 59 57
53 49 54 52 50 50 31 52 57 53 50 54 57 35 50 57 31
57 54 57 43 51 51 54 58 50 45 44 63 50 44 54 54 47
58 42 57 44 63 63 49 63 47 57 47 63 47 60 51 35 63
49 63 47 58 63 50 45 42 60 50 54 54 63 43 47 63 60
63 44 47 33 43 42 49 47 50 54 50 47 50 44 50 63 60
44 63 60 44 44 63 47 63 24 63 50 63 33 54 54 63 63
42 63 60 63 44 49 35 50 47 60 49 43 41 47 63 27 50
27 49 39 42 58 49 63 47 44 35 63 44 42 43 21 47 63
60 60 44 42 51 27 27 57 59 34 50 34 42 39 43 44 57
27 54 42 59 30 29 59 44 44 44 57 54 59 50 30 46 30
59 34 34 44 44 51 33 26 34 50 31 33 57 44 19 57 30
59 29 34 57 35 54 35 54 35 32 27 22 57 35 30 28 57
22 35 26 28 59 34 23 42 29 31 21 57 29 44 30 31 35
25 41 42 27 52 30 52 28 41 28 33 31 52 41 30 52 29
44 46 27 41 52 23 41 9 19 22 34 32 20 37 52 52 29
51 51 28 16 37 19 31 42 32 51 25 17 28 28 52 31 21
50 52 28 52 13 51 21 52 17 52 52 26 23 51 29 19 51
51 26 52 22 36 26 30 18 34 31 27 35 21 11 38 26 14
50 27 51 14 27 13 27 18 25 25 52 52 26 48 48 48 47
14 8 14 28 26 31 27 35 30 18 36 28 31 13 47 28 31
47 44 26 27 46 27 18 47 47 29 21 48 25 32 31 52 18
52 18 29 47 33 28 29 29 19 52 23 40 30 29 46 31 11
47 44 26 30 27 29 47 42 29 10 52 32 26 26 31 40 30
27 26 26 35 33 20 31 41 29 14 41 45 29 17 44 25 31
21 29 29 28 22 26 19 35 32 20 27 14 44 14 37 20 27
23 17 42 37 32 16 27 21 26 12 17 28 30 13 35 31 23
27 27 39 11 14 22 13 16 24 18 10 17 25 22 11 19 18
28 48 48 43 35 32 25 34 22 25 28 27 28 24 28 12 37
18 27 19 28 22 27 18 29 21 27 20 26 20 40 31 14 16
15 32 28 28 24 23 26 40 23 19 19 21 26 18 17 27 21
27 15 40 24 15 11 33 26 13 7 35 26 12 9 7 9 11
25 13 14 22 13 29 10 18 6 19 9 27 26 22 8 19 26
7 21 27 17 29 14 8 22 26 16 34 28 14 27 24 19 11
17 24 14 17 21 24 39 32 12 17 9 9 16 13 18 19 15
9 5 10 16 15 6 9 7 12 18 14 6 28 31 12 19 20
6 15 11 7 28 9 10 22 7 33 14 16 20 15 6 6 14
35 8 14 6 10 19 12 28 9 12 11 13 7 21 6 12 13
14 16 11 9 5 8 5 25 28 6 10 12 7 29 20 10 15
6 19 6 31 13 12 9 6 15 5 17 7 20 24 25 20 16
13 15 13 6 10 6 16 11 20 13 13 6 6 6 7 8 13
9 17 11 9 11 15 7 6 12 16 20 5 21 8 16 11 6
6 15 16 15 15 18 10 12 7 12 13 13 10 8 14 11 10
15 8 5 3 5