S03036-01_N02
Seqid S03036-01_N02
Sequence >S03036-01_N02.phd
NNNNNNNNNNNNNNNNNNGGCNNNANNNNNGGGCGATTGGCGGCCAAATCGGCCGAATTG
ATCATCAAACAAGCAACTACAAAAAAGCTTTACTGACAACTCACACAAATAACACAAAAA
ACAAAAACTTCAACAATGGTCGCCTTTTTAGAACTAACTTCTGACGTTTCTCAACCTTTT
GTCATCCCATCTCTTTCGCCAGTCTCTCAGCCAAGCTCAAGAAAGAACTCTGACGCAAAC
GTCGATGACCTGAATCTGGCTATTGCCAATGCCGCTCTTTTGGATGCCTCTGCTTCAAGC
CGCTCACACTCCAGAAAAAACTCTTTGTCTCTGTTGTAAGTGTTGTACACGAGAATTAAC
ACACTATTAGCATAAAAGACATTTGGCATCTTTACTTACTTGGGCAAGTAAGTCACGTAC
TTTTTTTTTTTTTCCGGAGCATTCATTGTCATTCTATCTGCACTTTCCCGCACTTACATT
CAATAACCTCGGATCGGGTCTCTTCTACGACAGAAACTTTTTGATATATACATATTTATG
CAATATAAATACTGAGAAAGTAAAAAAATTTAAAATATAAAATAATAAAAAAGTTACTAT
TACTATNAAAANNAANGNNNNAANANNAAAAAANNNANNTGNNANNNACCGGCCATAAGG
CCAGCTTGAGTATTCTATAGTGTCACCTAATAGCTTGNCGTAATCATGNNCATAGCTGTN
CNGTGTGNNTGTNNCNCTCANATCNCACANNTACNAGNCNGNANCATAAGTGNANCTGGN
GCTATGNNGANCTACTCACATATGCGTGCGCTCACTGNCNNTNNNGTCGANNTGTCGTGC
AGCTGATATGATCGTCN
Quality >S03036-01_N02.phd
2 3 3 3 3 3 2 3 4 5 3 4 4 5 3 2 6
5 11 12 8 5 5 5 10 3 5 3 3 5 9 22 19 14
28 31 17 36 29 12 10 40 26 13 28 13 17 27 48 40 46
28 37 41 36 27 19 34 45 41 15 24 34 33 43 33 38 43
50 41 35 29 41 35 49 50 37 43 47 42 37 49 51 49 49
49 49 50 49 49 35 46 43 49 52 42 50 26 40 49 52 50
46 52 52 50 47 54 54 49 49 54 50 50 54 50 54 59 59
54 54 54 50 49 49 54 54 57 57 54 42 54 50 50 54 49
49 51 50 54 57 50 57 50 46 46 51 51 42 42 59 59 54
50 50 43 57 59 57 57 57 57 53 42 43 57 51 51 57 57
57 57 54 57 57 53 53 53 53 53 53 51 54 51 57 57 57
57 50 53 53 57 53 53 53 53 53 51 50 50 50 51 53 57
57 53 53 54 54 57 57 42 42 59 54 57 57 54 50 57 59
57 57 57 59 59 57 50 59 59 59 57 45 33 43 49 54 54
57 54 59 59 59 54 57 50 51 45 31 53 57 57 57 59 54
49 57 57 57 54 54 46 50 53 51 54 52 42 57 59 59 51
53 50 53 57 57 50 57 57 51 53 52 50 42 57 54 53 51
57 59 57 50 50 57 50 35 53 57 57 53 50 50 49 49 42
54 54 50 57 50 50 50 54 57 53 53 43 43 53 42 54 57
54 57 53 50 49 49 49 49 49 57 50 57 59 59 50 53 50
54 52 35 46 51 39 49 50 42 50 50 57 50 57 54 32 54
54 57 54 54 54 54 54 57 54 54 51 50 54 57 54 54 49
53 53 53 49 51 37 49 50 53 53 49 50 49 49 54 54 54
53 53 49 54 49 57 54 54 54 57 57 57 57 54 37 57 43
59 54 53 54 54 54 54 43 49 54 59 54 49 53 53 53 53
53 53 53 53 53 53 53 49 43 49 49 51 50 26 46 46 42
51 46 35 52 52 49 37 50 52 50 53 46 49 52 49 49 49
49 37 33 49 49 47 46 49 51 43 36 46 34 40 49 51 40
46 32 51 53 42 31 51 31 49 49 46 51 40 46 46 49 42
29 49 46 51 51 35 41 40 43 46 51 37 42 37 46 34 52
33 46 32 50 52 51 40 46 52 52 52 52 50 50 22 34 34
40 36 41 49 37 39 49 41 47 49 41 36 50 35 30 20 32
46 46 48 51 50 41 36 34 36 35 47 29 43 51 52 35 39
31 51 51 51 48 47 40 29 47 40 24 37 34 47 30 31 35
31 47 37 41 36 33 43 34 24 16 21 22 34 42 30 40 26
26 41 29 35 31 40 30 37 34 21 10 3 9 9 16 12 5
7 10 9 5 9 7 6 5 6 10 12 6 23 5 7 17 9
15 19 12 12 7 7 5 10 5 7 9 12 7 7 10 3 3
6 9 39 24 18 26 16 32 18 23 23 9 14 10 14 31 12
20 30 33 31 26 20 21 28 18 23 22 14 17 26 20 17 16
18 34 16 28 12 18 16 22 20 19 12 28 21 22 23 19 16
3 10 30 25 18 21 16 28 23 12 12 3 5 14 19 24 28
14 16 20 15 8 5 8 5 13 8 18 11 8 5 3 8 8
10 6 7 18 6 12 21 17 16 7 11 12 8 5 14 10 13
18 6 7 17 17 15 7 24 11 7 15 3 10 3 13 6 21
23 12 21 26 10 15 20 7 16 5 12 16 16 16 2 12 28
15 34 14 9 7 6 9 12 6 16 20 31 14 15 9 10 13
10 25 12 8 8 8 12 30 14 12 10 8 15 13 16 18 20
8 4 14 5 7 13 2 7 6 15 15 14 8 8 2 5 8
18 8 13 11 8 24 20 15 15 9 15 15 8 19 14 8 12
24 21 11 19 9 13 7