S03036-01_N03
Seqid S03036-01_N03
Sequence >S03036-01_N03.phd
NNNNNNNNNNNNNNNCNNGNCNNNNNNNANGGNGATTGGCGGCCAAATCGGCCGAATTGA
AGGCAAAGTTCTTAATTATGCAAAATCGCCGTATATGAAATAGAACAACTTTTTATACAG
CTTAAATACAGAATTCAAGTATGTTAATCAACATGAAAGAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGGTACCGGCCATAAGGGCCAGCTT
GAGTATTCTATAGTGTCACCTAAATAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGT
GTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAA
AGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGC
TTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGANTCGGCCAACGCGCGGGGAG
AGGCGGTTTGCGTATTNNNCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCNNT
CNNTCNNTGCGGCGAGCGGTATNNGNTCACTNANNGCNNNNNNACGNNNNTCCNNNGANC
AGGGNNNNNCCNGANNNAACATGNGAGNNAANNNCANTNAAAGGNNNNNAACNNANNANN
NNNCGNNNNTNNNGTNNTCCNNANNTNCGCNCCCNAGNGAGNTNNNAANATNNAGNNNNT
TCANNNGNNNTANANNNGGANNNGNTATAANATCANNGGNNNNNNNNTNNNNATCCNAAC
TNGAGTCCNTGTCGCTCCNNNNNTTANNNNTANNNNCGCATNTNTAANNCTAGN
Quality >S03036-01_N03.phd
3 3 2 2 7 4 3 3 3 4 3 3 3 3 3 8 6
6 8 5 8 3 3 3 5 3 7 5 9 6 14 12 5 17
19 16 34 24 8 8 29 25 12 18 14 16 23 35 26 41 29
36 29 35 22 15 30 49 30 13 13 23 26 27 28 32 36 35
49 49 27 49 30 35 36 36 28 35 42 35 36 34 15 21 37
46 52 34 42 49 46 42 49 49 41 42 35 28 31 35 35 32
35 43 43 46 41 38 49 46 38 38 35 27 32 36 38 46 32
46 54 54 42 46 35 43 49 54 54 43 49 50 50 50 49 43
36 43 49 44 49 50 46 46 35 36 46 52 52 42 49 50 52
49 50 43 46 46 46 47 43 37 41 46 46 49 49 49 49 46
46 39 37 37 49 49 49 49 36 33 33 32 46 37 50 32 32
33 33 33 32 34 38 45 35 40 46 49 49 49 49 46 37 46
37 35 40 49 49 49 37 37 36 28 37 25 9 16 28 11 29
32 21 22 33 29 20 33 35 40 50 40 26 31 35 31 30 28
36 27 29 21 35 35 27 42 41 36 29 31 31 40 17 19 29
33 46 31 42 35 31 40 41 37 28 40 23 26 38 31 42 44
35 30 31 36 30 31 34 31 31 40 45 26 34 34 29 50 37
33 35 42 40 41 35 35 30 29 35 17 50 17 34 44 50 40
30 44 26 43 38 20 38 36 41 26 40 29 31 18 29 36 40
35 50 32 41 17 30 26 23 36 40 16 33 29 34 31 24 37
31 40 35 34 31 32 38 22 35 30 34 34 47 30 30 29 35
34 35 41 35 30 26 29 24 35 52 41 48 15 32 16 36 35
47 41 30 48 31 35 30 41 44 24 48 46 35 33 38 31 35
25 36 26 40 41 26 31 42 41 35 28 30 35 45 44 29 26
41 30 35 19 27 38 41 19 48 32 25 26 40 41 30 12 26
15 32 32 29 26 47 26 24 37 35 14 24 28 28 21 18 27
16 32 13 43 18 22 29 31 26 30 17 30 28 23 32 17 26
9 7 11 27 33 41 30 24 13 15 8 16 31 17 18 24 27
27 24 14 13 28 17 32 15 31 30 14 28 21 20 21 30 30
21 20 13 7 3 6 11 17 25 20 18 15 23 10 21 20 21
27 39 10 30 26 21 29 16 28 13 30 17 30 27 31 15 27
15 19 27 35 27 32 13 30 23 8 3 5 8 16 7 7 27
9 7 3 8 18 15 8 40 13 27 17 8 10 8 12 15 11
17 7 5 8 7 22 12 9 13 18 5 8 5 3 18 9 7
7 7 5 5 5 10 20 12 7 3 5 7 13 8 14 6 7
6 10 10 6 12 9 13 18 9 5 5 3 3 3 9 9 5
12 8 5 3 5 15 23 14 17 12 8 5 9 13 8 5 3
8 19 7 5 3 8 10 6 11 6 21 26 15 12 9 5 7
7 7 7 12 10 8 6 6 9 7 3 9 5 5 5 5 5
8 8 5 5 7 7 8 3 3 3 13 16 7 5 10 9 14
5 7 9 7 5 9 7 11 9 14 5 16 24 19 7 9 9
6 9 11 15 6 10 6 6 6 10 8 5 8 13 6 6 12
9 5 5 6 7 9 11 9 9 6 6 7 8 5 5 6 9
15 6 16 6 6 7 9 10 13 5 5 5 9 6 9 16 11
15 10 7 9 11 9 8 6 7 12 19 6 6 6 4 4 5
6 7 8 7 6 6 5 8 10 12 11 6 9 10 9 12 6
9 12 9 11 10 11 6 12 24 18 9 9 9 9 8 12 7
6 6 6 6 8 9 13 7 6 6 6 9 8 6 7 7 6
9 10 12 16 11 6 9 7 8 9 9 6 6 9 8 11 20
6