S03036-01_N04
Seqid S03036-01_N04
Sequence >S03036-01_N04.phd
NNNNNNNNNNNNNNNNNNCNCCNCANNNANAAGNNGATTGNCGGCCAAATCGGCCGAATT
GGTTGTTATAGTGTAGGGAACAAAGGTACATTATACAAACAATAACAACAACAGGAAATG
AGTTTTACAGGTTCATTAGCGCTGGCAGGTATTGGTGGTTTGGTGTACAAGTTTGGCGGA
GGCCAATCGTATGAAAAATTGCCATATGTCAACATCCCCTTCAATCAGTACTTGGATAAA
GTTTACAAGAAGCACTTCAGCAAAGTTATGAGCCGTACCAGATACGTGCTAATGAACTTT
TTCAAAGACGCATTTACAGGAGGTGCATTCATGTACCCGTTCAAAGGGTTTTTAGAGTTC
AACACCAATAAGAGCAGTTACTCAACGACTATGTTAGGTATATTATCGAGTTACTTGATA
ATGTTTGCCCTGGTAAGCTTTGTGTATTGGGCTACAATTACGCCAATGTACACAGCTTTT
TTGATTGTGCTGGGCCCTATTGGGCTTTTCATTGCCATTTTTCATTCCTTTTTGAAAGCA
AAAAGATTTCACTTTATTNNCTATNAGGNNTANNTCAANTTAATAATTAAAAAAGTGGAN
GTCTGCTTTCGNNGAGAAANNGAGGAGNAAAAATATGAATTNNATTGTNNGTANTAGAAN
TCAGAGAAGCGNAGNANAGGGATAACTNTNAAGNTGAAGNNANGGACANAAACAGNNNNN
NGANACAGNGTAGANANGTNGGGTGNAGNNCGNTNCNNNATAGNCANATAAACATNNAAT
NNTAANCTAGCANACNNGNTANANAGANNAGANTCTACNNAANCGTACGNNCNTTNNGTT
TTTACGACGAANGAAATNANATTANAATAAGNGAAAANAATGAAAAAATTCT
Quality >S03036-01_N04.phd
4 3 2 3 3 2 2 2 4 4 6 5 3 5 6 5 5
7 8 7 11 12 6 9 8 5 3 3 12 6 10 9 9 7
6 15 15 14 17 26 7 8 14 12 9 11 8 9 17 40 32
32 24 27 31 28 20 12 26 30 27 14 25 42 29 26 21 34
27 28 30 47 26 35 35 21 33 30 28 34 13 40 41 46 35
30 21 10 29 22 42 42 49 42 46 42 28 28 30 30 15 20
26 29 26 42 29 33 42 26 28 38 21 35 35 30 31 35 30
38 46 54 43 43 35 32 40 40 31 54 50 49 42 54 42 47
42 45 39 54 42 54 43 46 46 50 42 44 50 42 50 54 59
54 42 49 51 42 35 49 49 50 42 49 57 59 42 59 50 49
49 54 54 50 51 42 42 59 54 41 23 39 32 49 46 49 49
50 42 42 49 49 51 57 54 51 46 51 47 51 50 50 50 44
53 47 53 51 49 49 43 49 49 42 50 50 49 46 46 46 44
49 35 44 49 54 39 42 43 46 50 50 46 42 38 33 32 36
36 37 43 36 32 29 32 42 36 46 46 51 49 46 51 49 44
53 46 44 46 42 44 42 50 49 43 49 51 43 45 49 49 49
50 50 50 50 50 44 47 44 50 57 42 54 50 50 50 49 49
50 50 51 50 57 54 51 46 50 57 59 53 53 44 39 50 51
50 57 38 50 50 54 49 53 51 50 54 39 57 53 45 31 51
50 50 50 50 44 51 50 43 49 53 49 46 54 54 50 49 50
51 49 27 50 49 49 46 41 28 44 44 44 44 47 49 49 49
42 46 43 43 42 46 46 42 44 35 43 44 43 44 46 57 54
49 49 49 43 49 42 34 49 44 36 46 49 42 54 50 49 42
51 46 46 49 42 44 44 44 44 39 43 44 33 37 42 38 30
50 43 30 33 43 30 49 46 49 44 35 43 43 36 45 27 31
43 33 35 43 46 44 44 46 35 35 42 39 38 44 32 38 38
32 34 39 39 39 42 33 13 29 39 43 39 27 20 21 32 43
32 33 20 30 40 35 42 35 40 35 35 40 24 35 24 27 29
17 20 21 18 18 22 39 25 16 35 43 20 42 35 35 30 30
24 11 22 21 35 47 35 47 32 12 13 21 35 33 21 21 22
26 47 42 46 39 42 46 46 35 22 10 8 18 16 32 20 19
22 22 32 19 24 20 10 8 9 19 19 14 20 19 14 12 8
19 11 25 41 24 18 11 17 22 31 26 17 18 10 5 5 11
11 15 9 6 10 8 10 6 7 11 12 6 7 8 11 11 9
6 8 8 13 11 14 14 24 11 8 13 11 8 9 14 14 9
10 13 8 23 6 9 9 10 9 10 19 11 12 10 10 8 6
7 9 10 14 11 9 11 6 6 13 10 8 10 35 9 6 11
12 12 24 18 9 11 10 8 9 12 11 14 6 6 9 9 13
11 9 6 6 9 10 11 6 9 9 12 23 10 7 11 11 9
10 10 10 14 18 8 12 9 6 9 8 6 9 6 10 8 10
9 15 13 14 16 9 9 6 8 6 10 11 11 6 14 13 15
15 10 6 7 11 6 10 10 8 16 11 7 9 9 10 8 10
8 6 6 6 7 6 7 10 14 6 11 10 9 10 6 10 11
20 8 12 6 10 6 9 9 6 9 11 9 9 11 6 11 11
6 6 10 8 6 11 6 9 6 6 7 9 11 10 10 7 10
8 6 9 9 10 11 10 9 14 9 6 6 11 11 8 6 6
14 14 8 5 9 9 14 10 9 14 6 14 11 6 6 9 7
8 10 6 10 6 8 8 14 6 6 14 11 11 6 8 11 11
11 10 6 6 8 8 6 11 11 9 11 8 9 6 6 9 7
9 8 7 7 9 10 11 10 9 8 8 8 11 11 10 11 11
10 7 8 9 9 9 8 6 11 6 8 11 9 8 6 14 10
11 9 9 9 6 8 9 9 8 9 6 9 11 9 9 14 9
9 10 11 9 9 10 11 9