S03036-01_N06
Seqid S03036-01_N06
Sequence >S03036-01_N06.phd
CNTNNTTTNNNNTTNNNNNNNNNNNNGGGCGATTGGCGGCCAATCGGCCGAATTCCCATG
GGGATCCGATATCAAGCTTGGGCCCGGTACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
GGAAAAAGCGGNNNTAAGGGCCCCCCTGAGTNNTCTTGTGGGGCGCTNAAAATGCCNGGG
GNATACGTGGNGAAANCTTTTTCTGGAGAGAAAGTGGTACCCACTGACAAATCTAACTCA
CATTAGNTGCGGAANCTAAAAGGGCACGCTCGGGGCGNGCAACCTGTCGGGATAGGTGAA
TTAATTNGTTTGCCCCCACTCCCCCATATTCAAAAANNAAATAGGCGCGCGCCCGGCTTC
TATTATTCGGACAACGTGCCGGAAAAAGCGTGTGTGAGATTGGCCCCCCTCCTGCTGACA
GAGGGTAAGNGAGAGGNAGNGTGGGTTATGTTGATTGTTAGAAGCGTAATAGATATAAAA
AAGGGGGGAGNAANTTTTTTAGAAAAGAAANNAGAGAAAAACAAATAAANCCTTTTTCTA
CCTNTTGGCCCGNGAGGGGAGNAGAAAAATATAAAAAANTATANTTATTAATTTTGTAAT
AAACACGTTNNNGAAGAAAGNNTGGNGAAANNAAGTNNANAGTTANNGGAAAAAGGGGAA
AAAAAAANCAATNCTCTNNTATATGGTATGGTGTTTTNNGTGTATTTGTGNTTTTTTTTT
TNNNNGGCNNCACACTCACAAAAAGGGAAGGAAAAAGCGGAGGGCTTTTTTAAATAAGAA
AAAGGTATGGTAAAGTAAAAGATAAAGATAACACTTTGCGCGTAGGGGAGTTGGGANGGA
GGGGAGTTAAAAAAATGTTAATTACTAAAA
Quality >S03036-01_N06.phd
9 6 14 6 7 8 10 8 3 6 3 7 8 8 3 5 6
5 3 5 5 6 5 6 5 7 8 15 21 10 32 30 15 42
50 23 20 60 18 22 11 23 16 57 52 57 38 52 54 52 63
17 46 57 52 40 29 21 60 63 58 57 58 16 16 60 52 57
52 52 47 52 46 41 52 57 57 60 59 58 57 48 52 63 58
57 63 52 42 48 48 57 57 43 43 60 60 60 60 60 60 60
60 60 43 43 47 60 60 60 60 60 60 43 43 46 47 60 60
60 60 60 43 43 60 60 60 60 44 42 35 33 36 39 33 33
35 46 43 46 35 35 29 29 26 28 33 34 37 39 37 33 37
33 33 37 37 30 28 26 35 24 24 15 12 17 24 24 24 24
26 19 15 22 33 15 12 12 31 19 19 12 13 18 21 21 15
9 15 10 9 7 7 7 9 9 9 10 26 21 9 16 9 10
15 11 20 29 13 28 9 6 6 9 13 21 17 12 11 15 11
15 10 16 14 18 9 7 22 41 28 21 10 10 11 12 6 29
32 12 26 7 25 14 10 21 12 9 26 13 7 8 10 15 20
6 10 16 28 27 27 20 9 10 9 10 9 10 17 20 13 18
17 14 12 20 13 23 17 17 30 16 11 10 16 12 9 15 11
13 14 17 18 9 9 12 18 12 18 30 16 35 26 21 28 14
7 12 21 21 18 13 10 10 7 9 11 14 16 13 11 27 22
15 11 11 11 11 16 10 21 12 22 32 22 12 23 7 13 11
11 10 10 10 16 42 17 11 38 16 34 14 12 19 18 11 18
14 11 11 10 13 23 24 11 14 7 10 11 13 16 34 35 15
11 11 14 10 33 12 18 11 11 16 9 10 8 9 22 12 14
9 20 10 9 9 6 7 35 26 10 10 11 19 18 12 11 13
20 11 12 11 14 15 16 9 9 11 11 12 16 13 14 16 12
14 19 13 19 17 10 20 19 11 14 17 15 18 18 13 26 32
28 32 22 26 14 33 10 11 19 16 17 14 14 12 13 16 16
12 9 13 19 19 18 12 18 11 10 13 14 19 11 18 14 11
11 10 11 12 12 9 14 15 11 11 25 12 12 7 10 9 9
21 24 10 7 14 21 6 9 14 15 11 9 10 9 11 15 11
17 16 11 11 18 11 10 9 9 11 14 31 11 11 10 9 12
28 15 10 13 30 12 24 22 10 11 11 11 10 18 32 13 17
10 9 9 9 8 11 6 9 9 7 8 9 8 10 14 10 11
26 21 16 15 13 13 13 9 11 6 6 11 8 20 12 32 14
19 14 9 10 14 13 11 14 14 22 11 6 10 12 13 11 20
11 12 8 12 11 8 9 11 7 11 11 10 12 10 11 18 16
7 9 9 22 10 12 9 13 10 6 34 18 13 11 15 14 16
16 19 21 11 9 18 11 14 14 6 9 10 11 11 6 9 19
28 14 14 19 11 11 11 19 19 20 20 18 11 14 13 19 26
15 27 14 10 9 14 6 6 5 8 11 11 14 14 15 19 14
5 5 11 8 9 6 9 9 18 17 6 7 22 19 14 8 6
5 10 6 14 20 15 9 10 6 6 11 14 14 14 15 10 14
8 10 9 8 19 22 22 14 10 11 11 9 9 7 11 11 9
10 7 14 15 13 9 6 6 10 11 11 13 16 12 11 9 8
13 11 11 12 12 10 11 11 14 7 7 8 10 8 9 9 10
14 11 17 10 9 7 9 11 9 11 10 14 17 19 15 24 6
6 6 7 8 10 8 7 6 10 11 11 14 11 8 10 8 14
23 17 14 8 9 11 8 8 8 10 9 11 13 14 28 22 17
20 15 14 16 21 17 17 20 11 9 13 14 17 20 14 10 19
27 17 17 17 19 15 20 23 19 24 16 19 11 12 16 20 12
8 11 16 19 20 20 12 20 23 19 19 14 10 11 19 13 19
20 19 17 17 19 20 17 11 16 23 23 23 25 23 13 10 13
12 19 16 15 27 16 15 18 18 23 9 9 7 20 19 19 17
19 13 20 18 19 16 10 11 17 18 22 20 17 23 27 22 23
17 18 20 20 23 23 22 18 27 23 20 15