S03036-01_N08
Seqid S03036-01_N08
Sequence >S03036-01_N08.phd
NNNNNNNNNNNNNTTNTCTTGGCCNNANNNNNNNGGGNGANTGNGCGGCCNNNTCGGCCG
AATTGATACTCAAGTGCTAGACATCCTCCAACATCCGCCAAGGAAAACAGCAAAAAAACC
CTGGTCATGAAGCCACAGTGCATACTCATCTCTTTGCTGGTCAACCTCGCATACGCAGAG
GAGTATTTGGTGAGGTTCAAAAATCCCACAGCATTCCAACAATTCACTTCGAATTCCAAC
AGGTCATGGAGACAGTTCATCGACAACAAAATCGAGAAGAAATTCTCCATCGGATCCTTC
CGCGGCGTGACCATGAACCTGTCCAAGAACTTAGTGAACAAGCTGAAGAAAAGCCCTCTG
GTGGCTGATATTGTGCCCAACTTCAGGTTCGAAGCTTTTGAAGGCGACAGTGTAAATAGC
GCCGAGTCGAGTTATACGTTTAACGCTACCGCCAAATACTCGTACGAAGACATCGACGAA
GAGCAAAACATAACGTATCAACCAGACGCACCCCGTCACTTGGCCCGGATTTCCCGCCAC
TACCAACTCCCATTCGACGTTGGGGGACAAGGACCGCTACAAAAGCTGGTTCAACTACTA
CTATGAACACGACTTTCAAGGGCGAGACGTAAACGCCTATATCATGGNTACNGGAATCTT
AGAGATAGGCTTGNCGAAAAAAGGGTTGGACGAACACATCCCCCCCGAATNGGGGGGGAG
AGGAGCAGAAGTGCTAAAACGTTGGTTGNTGTTGAAATGTGAAAAAAAAAAAAAAAATAG
AAGAATTTAAAAAAGAGGAATATTNATACAGAAAAAAAAAACACACTCCCCATGAAGGGG
GGGGAGGGGGGGGTANNGATAAAAATTTTAANNNACGCGCGA
Quality >S03036-01_N08.phd
4 2 2 3 2 3 4 2 4 2 2 3 3 14 13 5 26
8 11 9 11 11 12 9 7 5 8 5 5 3 7 5 7 5
8 8 8 6 11 9 5 9 29 7 16 10 26 24 10 12 7
5 7 22 27 48 22 31 35 29 24 13 26 30 21 12 27 19
31 30 24 21 25 34 28 35 28 30 44 35 27 20 41 42 36
41 41 41 30 28 42 33 26 35 35 35 30 38 33 28 52 42
38 30 32 35 27 35 38 38 38 33 31 41 30 33 33 32 38
38 35 31 43 38 33 42 35 43 50 43 54 50 54 50 42 50
36 33 44 50 54 50 49 54 50 49 47 50 54 50 57 50 49
49 51 57 54 54 54 50 50 50 54 54 50 54 50 57 54 49
51 57 57 57 50 51 50 52 57 57 54 45 44 50 49 45 53
49 50 50 49 57 54 54 50 50 51 51 54 51 57 57 49 50
50 53 53 54 57 57 57 50 46 49 50 54 45 50 50 50 49
49 54 57 54 54 50 54 54 54 39 46 46 50 54 54 44 44
60 47 47 50 51 47 40 40 47 47 63 44 44 34 35 27 49
60 54 50 50 60 50 60 54 60 54 60 59 44 54 49 49 49
57 54 58 54 54 54 50 58 60 50 44 54 63 60 58 51 47
60 54 54 50 42 39 50 50 54 57 54 54 50 46 57 57 54
57 49 51 31 44 49 49 49 50 50 49 47 52 57 54 57 50
50 28 46 32 53 51 46 46 46 49 54 50 51 50 54 42 42
54 59 54 54 54 54 49 42 49 54 59 54 50 50 50 49 50
49 50 49 50 34 57 50 50 57 57 51 42 49 50 57 50 39
41 44 54 54 34 51 46 52 54 50 54 45 50 43 46 46 43
49 54 54 54 50 49 46 49 50 54 49 35 45 44 44 44 27
44 49 50 50 49 54 54 50 50 50 49 39 44 36 50 36 50
39 49 49 49 50 49 39 50 42 46 43 47 49 50 60 54 44
60 42 49 47 49 47 54 59 59 47 54 44 54 60 54 50 50
59 60 59 54 54 44 50 54 44 60 44 29 27 47 42 32 44
44 29 54 60 50 54 44 44 44 44 60 54 44 33 44 35 47
47 44 44 47 44 44 35 50 60 47 28 20 49 44 35 44 34
35 44 46 46 52 46 46 44 34 44 44 29 33 29 44 47 46
44 47 27 60 47 34 47 39 44 19 17 11 30 44 44 44 46
30 46 46 47 46 41 35 46 47 47 46 22 46 26 32 46 46
19 47 47 47 19 46 35 10 19 14 26 29 23 46 10 15 9
12 46 32 46 46 52 16 41 20 31 30 16 20 27 24 20 11
17 11 17 16 27 36 16 14 10 13 35 18 15 9 11 16 23
32 22 11 25 17 11 11 53 28 16 9 9 11 24 22 11 22
15 9 10 24 13 14 11 14 19 11 12 12 40 19 14 27 46
12 7 13 14 8 7 13 11 8 22 14 28 24 26 18 8 9
15 14 11 11 13 14 12 13 12 10 6 8 11 11 10 11 28
27 16 12 15 11 13 13 17 9 11 13 13 15 13 13 13 11
11 14 17 18 22 20 20 20 14 10 15 22 12 7 11 9 14
15 10 10 10 11 20 10 14 26 20 27 12 13 11 15 12 19
16 11 12 20 20 11 14 16 11 9 11 9 11 14 14 11 19
7 11 9 9 8 10 13 11 15 9 8 9 9 10 17 11 20
10 11 9 22 11 13 14 22 10 9 11 9 9 18 9 9 9
9 10 12 10 10 8 15 14 13 32 13 15 12 19 17 11 11
9 16 27 10 11 6 14 9 11 16 18 11 14 19 17 17 11
13 16 16 13 14 10 11 14 20 18 11 11 15 23 16 11 14
13 19 15 17 13 9 11 17 28 32 14 24 21 19 19 13 11
10 10 11 10 9 6 7 14 13 19 19 15 9 8 10 14 14
14 12 15 16 1 1 1 20 20 23 22 22 23 17 16