S03036-01_B09
Seqid S03036-01_B09
Sequence >S03036-01_B09.phd
NNNNNNNNNNAGNNAANNNNNNNNNNATNNNANGNGNGGTTCNNNTTTNTTANNNCNTNN
NAANNNGANCTTTTTTTCTGTNNTCGAGGATGGGGNANNTTAGGGGTGGTNTTTTTTTNT
TTATTAACATGAGGGNGAGNTGATGTCGACCGNATATNTGGTTTNGAACNATCGNNATCA
GTAANCGCGGACCCCNNTGNCGGNNGTNGANGATTTGGGGGGGGATTNCNACTGTTTNNT
AGANACNAANNAANAAATGCCATAAAGGAAGTTTNCATGTTAGGAGATTTNNAAAAAAGA
AAAANNAAATCCAGAATCTNTTNCGCNNTGGANGTGAAGAAGGGGNGGGGGATTTNTTTT
TATATTAGANANAAAAAAAAAAAAAAAAAGGNNGTCCTTTTATANTTTTTTGTGGANAGA
AAAAAAAAAAAAACANCCTTTTNCCCAGGGGTAAGAAANGAAGGAGGGGANAATNTNTTT
TTTTTAAAAAAAAAAAAAAAAAAAAGAGAAAAAGCNGNAAANCTNATAAGTTNATAAGAA
AAAAAAAAAATATTCTCCANCCAGGAGGGGGGGGGGAGGGGAGGAGAGGTTTTTTTATTA
AATAAAAAAAAAGGANAAAAATTCANAAAAGTATATTNNTTTATTTNAANTTTAAAAAAN
TNTCAAAAAAACTCCGCCCGCGAAGGAAGAGGGAGAGGGAAAATAAATAATTAGAATNAA
NTNNAGCAGCAAAAAGTACGNNAAAAAATACACGAACNAAAAAATATATAAGTACAGCCA
ATNAAGACCAAAATCAAGAGCAAGCGCNAAAAGATAGGANTATANAAAAAN
Quality >S03036-01_B09.phd
5 3 5 3 2 4 2 5 5 7 9 11 3 5 9 8 6
5 3 3 3 5 6 7 5 6 11 8 5 3 3 15 6 14
7 10 6 9 9 10 11 9 6 7 5 13 10 11 5 8 9
11 7 7 6 9 5 8 7 6 7 9 11 7 6 7 18 8
7 9 9 8 11 15 11 14 14 10 11 8 8 7 7 12 9
8 10 9 9 8 11 13 15 14 10 6 10 7 6 8 8 9
10 15 16 13 10 8 8 14 7 10 11 25 18 19 10 9 6
20 11 15 11 29 12 9 9 10 24 32 32 19 14 9 9 6
11 11 11 6 23 37 10 9 27 11 10 18 11 11 8 14 6
8 10 8 11 6 23 9 8 9 10 9 6 10 38 9 8 7
14 9 9 8 6 6 9 11 11 11 11 13 8 9 6 9 9
11 10 8 19 14 9 10 14 6 6 8 11 6 12 11 9 6
6 9 8 5 10 8 6 8 10 11 10 9 19 37 12 17 11
9 19 8 9 11 10 6 9 5 8 11 12 11 20 8 11 7
6 20 9 8 36 6 9 8 6 9 16 6 6 11 17 6 53
18 11 13 12 8 8 11 17 9 9 9 14 9 9 10 11 12
10 18 6 10 10 10 18 9 10 10 11 18 9 11 11 9 10
15 6 6 8 14 28 11 11 10 11 9 19 16 13 12 6 6
11 9 11 9 9 9 9 9 10 10 11 10 11 6 13 12 6
10 11 10 6 6 8 14 8 11 6 11 8 11 8 10 11 9
11 9 11 10 16 6 13 14 15 21 9 16 9 10 9 6 8
9 12 13 12 9 10 10 10 11 8 9 16 6 9 6 9 23
31 28 28 35 26 25 20 26 9 9 13 12 9 13 14 17 10
7 7 9 11 11 11 9 14 21 11 11 18 9 6 10 10 10
11 11 9 10 19 19 10 14 7 10 9 15 37 14 9 8 12
9 23 16 11 15 9 11 14 11 11 6 11 8 9 9 9 9
6 11 13 14 16 11 12 11 14 8 9 11 11 9 10 9 6
12 15 9 9 9 19 14 11 11 9 17 6 13 12 9 6 12
6 11 23 18 14 24 13 9 15 11 14 12 14 12 14 16 9
15 32 10 10 9 13 30 17 11 13 18 9 9 20 11 10 19
23 10 9 9 9 6 10 6 8 15 11 6 9 11 6 13 9
23 25 16 11 11 6 11 9 11 16 16 14 12 14 9 9 8
11 9 22 27 12 14 9 11 9 9 9 11 16 9 10 6 9
9 11 8 16 13 22 14 12 14 9 11 11 11 16 13 11 12
11 12 17 8 9 10 11 14 14 9 9 10 19 12 13 10 14
13 9 11 18 11 10 9 9 10 11 17 15 18 11 10 11 9
8 9 9 7 34 14 16 9 11 14 13 9 14 7 8 10 28
10 9 13 15 11 13 10 18 7 6 10 9 14 21 9 16 23
7 10 9 6 9 14 11 11 15 16 19 16 11 7 8 6 9
13 16 9 9 10 25 10 18 15 14 15 15 16 11 15 13 10
10 8 9 10 10 9 14 9 14 10 11 10 10 14 11 11 9
9 9 10 10 10 18 10 16 13 13 13 13 12 13 11 13 13
11 15 14 7 14 9 7 11 6 6 18 10 15 15 9 9 23
12 13 22 17 10 10 19 18 13 7 6 9 16 16 17 12 10
12 11 10 15 13 11 11 14 10 6 13 11 14 10 15 14 9
10 11 9 9 9 12 9 11 19 11 11 9 13 11 11 11 11
6 8 15 10 11 11 12 9 9 9 11 9 11 11 11 9 8
8 9 11 11 11 11 8 8 6 9 11 13 9 9 9 9 11
10 12 12 6 9 10 10 11 6 15 10 12 9 11 6