S03036-01_N11
Seqid S03036-01_N11
Sequence >S03036-01_N11.phd
GNNNNNNNNNNNNNNANNNNNNNNNNNNANAGGGNGATTGGCGGCCAAATCGGCCGAATT
CCCATGGGGATCCGATGGAGGGCTTTGAACACTGAGTTTGGAACTATCAGCCGTCAAATA
CGCATAAAATAACATCAAATACTCCAATAATGAACCAGTTAGGAGCTTTAGCCCAAGTTT
CACGTTTCACTCAAAACTTCTCCATGGAAAATATTAAGAGCGAGTTCCAATCCTTGCAAT
CTAAATTAGCAACCCTTCGCACCCCGCAAGAATTTTTCAATTTCAAGAAAATTTCCAAAC
CTCAAAACTTTGGGGAAGTCCAATCCAGAGTGGCGTATAACCTGAAGTACTTTTCCAGTA
ACTATGGTTTGATTATTGGTTGTTTGAGCATTTACACATTATTAACAAACTTGTTGCTAC
TCTTTGTTATTGTTCTAGTCGTAGCTGGTATTGTTGGTATAAACAAACTAAAGGGTGACG
AGCTCGTAACTCCATTTGGCTCTTTCAAGACCAAACAACTATACACCGGACTGATTTGGG
TTGCTGTGCCAATAGGTTTCTTAACTTCGTCAAACTCAACTTTGCTATGNTTGAAAAGGA
GCTTCTCCCCCTCAGCGTGTGCGGGACGTGGAGGATTGATGGAATAATCATATTAAATTT
TTAAAAATAAAAAAATAGTATTAACACCCCCACCAACTTTTTGGGGAAANGAGAGAGCCA
AGAAAAAAAAAAAACCCACCCCCCCCCACACCCGCGGGGAGGGGGGGGGGGANTTTGNAC
TTTTTTTATNNTTAAATAAAAAAAAGAGAANGAGAGNAAACGAANCGACACATTACAGTT
GGGGAAAAAAAACAACCACAACCCCCCCCCCCACNNANAGGGGGAGGGNAGGAGGGGGGN
AGAANATNTAACACAN
Quality >S03036-01_N11.phd
12 7 3 2 3 2 3 5 3 3 2 6 6 3 5 8 6
7 7 7 3 7 5 5 3 3 7 5 10 6 10 8 10 12
6 16 22 17 27 23 12 12 25 29 20 24 10 11 23 36 30
36 21 41 37 27 23 20 28 31 27 21 25 21 41 31 40 30
26 17 15 36 29 28 43 29 42 37 35 19 40 29 26 49 46
35 29 24 28 34 34 31 43 42 35 35 42 35 34 35 32 35
37 43 42 38 54 43 42 46 43 46 46 36 42 35 46 49 50
46 38 42 54 43 49 54 49 43 46 49 49 46 49 38 43 44
43 46 49 49 49 44 46 49 42 39 50 50 49 41 43 51 51
51 54 51 44 53 53 45 58 49 43 43 43 43 60 60 50 63
49 60 58 51 60 49 50 63 63 46 47 44 47 54 52 63 58
49 44 42 52 50 42 63 63 47 57 60 63 60 52 60 57 42
57 52 63 58 63 43 43 60 60 54 57 60 57 60 58 57 52
57 57 57 57 60 47 58 34 52 57 60 57 48 48 60 42 41
43 40 43 32 32 23 23 40 48 52 57 57 47 58 57 58 58
57 60 46 47 43 35 42 57 60 48 60 52 57 53 60 63 63
42 63 63 43 43 35 35 63 57 63 63 52 42 58 57 52 63
58 52 46 63 63 47 58 31 63 47 40 63 57 46 33 52 60
60 40 60 43 43 60 60 60 58 35 58 42 46 34 60 39 63
57 60 63 42 47 51 24 60 50 63 43 47 60 42 39 35 60
40 41 39 60 42 42 38 38 28 44 36 43 41 41 27 43 24
60 42 42 41 38 40 47 47 47 44 27 60 41 43 39 39 60
42 44 50 54 63 60 63 60 24 58 51 54 54 26 42 36 44
57 50 27 49 35 54 27 43 53 42 30 51 42 59 39 22 57
57 39 50 49 50 35 50 39 42 42 31 42 39 50 31 49 49
39 13 49 27 30 49 44 22 49 42 36 35 36 44 42 35 46
44 31 42 44 43 50 17 54 31 49 44 19 42 42 39 36 39
39 22 54 50 28 18 43 42 31 25 19 39 29 9 23 18 21
14 15 9 14 15 12 21 9 11 9 9 18 12 12 13 9 23
11 15 28 44 27 60 16 39 31 11 35 42 33 33 35 31 44
14 44 20 21 17 11 9 10 33 44 21 28 13 35 25 27 27
33 33 38 22 34 33 27 19 27 19 25 10 29 19 15 16 11
11 30 19 24 26 20 14 31 30 27 27 25 10 42 24 16 16
19 31 16 20 31 18 12 8 10 19 14 18 10 9 12 13 14
32 20 11 16 19 15 17 19 22 13 11 7 11 8 14 23 15
10 10 9 12 11 14 17 11 11 22 14 14 15 23 27 24 16
19 12 11 10 14 12 11 15 11 10 16 26 18 24 12 11 10
14 27 13 21 10 14 18 14 18 12 15 11 12 14 18 9 32
38 13 12 13 18 11 27 22 15 32 14 14 21 19 15 15 14
10 11 11 23 14 32 19 47 40 50 34 40 11 14 15 15 13
11 10 25 13 15 14 18 15 19 17 13 10 14 14 13 15 16
17 14 9 14 12 17 19 14 15 13 16 22 7 16 16 10 9
9 11 18 9 11 18 13 12 20 10 38 18 15 11 13 12 11
24 19 14 16 13 19 23 27 28 32 32 15 32 25 26 24 13
17 14 12 15 16 16 12 19 28 28 24 17 18 10 13 19 20
31 16 17 10 8 9 9 6 12 11 11 8 6 9 10 10 15
14 13 17 14 11 9 9 6 7 11 11 10 23 11 17 22 15
40 20 46 28 32 17 14 10 9 11 15 7 9 15 9 9 8
7 12 20 16 13 15 11 9 7 9 9 10 15 16 9 10 10
10 10 9 18 24 9 8 10 15 11 9 10 19 22 36 20 27
24 11 8 16 23 14 9 11 13 33 10 10 14 12 19 18 24
32 28 15 15 17 9 9 6 7 10 7 11 9 9 10 10 8
9 9 14 18 6 9 10 8 11 11 15 10 8 11 9 6 9
8 11 12 6 10 8 5 11 12 9 9 9 11 9 6