S03036-01_N12
Seqid S03036-01_N12
Sequence >S03036-01_N12.phd
NNNNNNNNNNNNNNNANNGNNCCNNNNNNNNNNNGATTGNNANCGNATCGGCCGAATTCC
CATGGGGATCCGATGGACACTTATAATATGTGTCATTTCTGGACCAACTTCGAAATCGGC
TCTTTAGACTTCTTCAGGTCCGATGCATACAGAGAATACTTTGATTACTTAGACAGTTCT
GGTGGATTCTTCTACGAAAGATGGGGGGATGCGCCAGTGCACTCCATCGCTGCCTCTTTG
TTCTTGGACAAGTCAGAAATCCATTTCTTTGACGGTCTTGGATTCCATCATCCAGATTTC
ACCTCTTGTCCTATCGAACAGAAGATTAGACTACAAAACAAGTGTATCTGCGAACCTAGC
AAGGACGTCACCTGGACTCCTGACTACTTCTGTACTAGAAAGTACTTTTCAGCAGGAAAT
TACAAGCTTCCACCAGGAATTTAAAAACCAAACTACAAATAGCGCCTGCTCCGTCAAAAC
AGGTGCAAAAACGGCAACATGTATNNATCTATATAACATAATTCNAGGTANGTACCATNT
GNAACAATAGGGAAAGTTGTAATAGGTNAAAAAATAGCAAAGNAAAATAAATAAAAAAGG
AGGGNGGGGGAGGAAGGAGGAAAANAAAAAANATGAAAGAAAATAAGAAGNATGGGTCGG
GGTAACATGNCGACGCANNCCCGGANTGCAANNAAANGANNTTCAAANANAANNTGATAT
GCTNCGAAAGNGGANAGNAGAATNNGTNNGTGGAACTAAATGAANCTAANAGCGANGGAG
ACAAGNGGAAGNGATANGTNATGGNGNAANNGGGACGANNTNNCNNNAGTNNNAGGGCGA
TCTTAAGNNGCACNNAACNAGCAAAACAAAAGAATNNAN
Quality >S03036-01_N12.phd
4 2 3 3 2 6 4 3 3 6 5 6 5 7 7 8 7
7 8 7 6 9 14 5 3 3 6 5 5 7 5 5 7 6
13 13 10 9 9 6 5 8 7 8 9 6 12 28 29 31 26
26 20 18 16 9 19 19 12 12 12 16 28 31 28 23 27 16
26 21 26 18 30 21 30 28 24 21 32 28 35 36 35 30 19
19 21 26 42 42 38 42 37 32 22 30 39 31 39 35 39 46
27 38 34 21 26 33 35 31 39 25 29 35 35 39 36 32 30
32 44 42 50 46 44 35 36 44 50 54 53 50 51 44 42 32
39 50 46 46 49 42 50 54 54 54 43 49 50 54 44 49 45
45 50 50 50 59 44 54 49 44 47 42 44 44 43 44 49 44
50 42 44 44 44 54 49 53 54 54 49 45 49 57 50 44 38
50 54 54 51 53 45 50 57 54 51 53 57 57 57 44 57 51
49 49 49 51 38 38 50 45 44 57 44 44 46 44 49 49 44
57 52 49 44 44 46 49 43 42 44 46 46 32 31 32 35 36
22 44 39 27 29 42 43 57 57 44 46 42 54 54 44 54 50
43 57 54 54 54 50 44 32 49 53 53 51 57 57 57 57 50
44 50 50 54 54 54 50 54 54 41 44 51 49 44 36 49 54
54 54 54 45 44 50 45 50 51 51 50 43 50 49 50 54 57
57 57 49 50 50 49 54 54 54 50 49 51 46 49 50 53 53
42 45 28 46 44 50 50 46 54 59 50 39 42 46 46 43 42
33 43 46 49 42 35 28 43 46 44 46 36 44 32 33 43 42
39 40 42 40 38 43 43 33 33 34 43 60 47 50 49 47 50
47 44 42 49 49 60 60 50 45 47 47 60 43 43 47 47 47
57 57 57 52 52 38 52 57 58 57 60 28 47 46 57 60 52
43 57 52 42 46 47 34 60 52 48 46 47 52 47 48 19 40
48 43 48 52 52 34 31 36 23 35 39 52 34 48 20 33 34
45 53 60 43 48 60 60 48 57 60 43 48 43 53 35 37 35
41 35 29 35 35 22 29 27 27 37 29 32 53 18 13 25 13
47 45 30 26 16 27 15 23 53 19 9 13 27 27 21 23 13
10 13 25 21 27 24 14 16 9 20 42 5 5 10 42 47 42
28 37 28 9 11 11 16 13 12 12 12 40 22 9 6 9 9
18 9 8 6 9 8 12 14 14 12 10 6 11 11 6 9 24
8 18 11 10 9 20 21 9 17 11 16 11 9 10 11 13 9
11 15 12 11 10 9 6 10 15 14 11 10 9 8 28 14 11
16 13 9 11 6 18 27 24 19 13 11 11 14 15 19 14 10
12 11 8 11 18 11 12 12 11 6 9 11 11 24 13 11 11
11 10 10 11 12 13 18 12 11 10 8 11 6 8 8 15 10
12 12 7 23 8 9 9 14 16 11 9 8 16 12 13 11 9
11 14 15 9 7 12 13 9 10 11 9 11 10 22 12 13 13
13 16 13 9 10 9 6 9 11 10 15 10 12 10 6 7 10
10 10 11 11 14 6 11 11 9 8 11 6 6 13 9 9 6
9 11 7 6 9 11 9 11 11 11 6 11 6 9 14 6 6
9 9 9 9 12 11 12 14 10 6 8 10 10 11 9 9 7
9 11 12 7 9 11 7 9 11 8 8 8 6 6 9 11 6
6 11 14 9 10 19 19 11 9 14 9 14 9 8 11 11 6
11 9 10 10 6 11 9 9 9 14 6 9 10 9 9 9 9
8 11 11 6 14 10 9 11 9 6 11 13 10 9 6 11 10
7 9 14 8 11 6 11 6 14 9 6 6 10 11 9 10 11
10 9 6 6 11 5 6 9 6 6 6 9 9 11 6 6 6
9 8 9 11 9 11 9 11 11 11 8 8 10 15 6 6 10
9 11 11 5 5 11 14 10 6 10 14 9 10 9 14 14 10
14 9 9 14 11 18 9 14 6 5 8 5