S03036-01_N16
Seqid S03036-01_N16
Sequence >S03036-01_N16.phd
NNNNNNNNNTTTNNNGGGCNCCNNNNNTNAGGGCGATTGGCGGCCNATCGGCCGAATTCC
CATGGGGATCCGATGACGATTACGAAATAACAGCAAATAACGAAGGTTGAAGAAATTAGA
TAATAGATGAGAAAAAAAGAACACCAGAGAGAGAACAGGTGCTTTCTAAAAGATTTCAAT
TCAGGGCGAATAATAGTAGTTCTTACCCCTTAATATATTGGAATATAATAGGACTAGTTA
GACGCAGGCAATAAGATTGGTTTATTGTTCTTTTTTTTACGACTGTAACAAAGCTACGTT
ATTTTTTGTTTTTCTTTTTTTTTTAATTTATTTGGTATTATATATCTAGTGTACATGTTA
TTATTAGGAAATAGCTGTTATTTAATATTAAGTGTGAACGAAGGACAAAGAAGAAAAATT
TTAAAAAAAATAAAAAAAAAAAAAAAAAAAATAAAAAGNNCAATAATCGGNTGCCGACCG
GAAGGCCNAANNTGAAAANCCTATAGTNCCNTAAAAAAACGAGANAAAATCAGAGCANAG
NCGGGTTCTCGGGANGNTGGGTTNAGGNNNGGAAGACCCCACCNCAAAANACCCNCCCGC
ACAAGGGGAAAGCGGGGAGGGATATGGCCCTAAATANTAAAAAAAATGNTTTAAAATACA
TAAAAGCTCCNGTCTGTAAANCAAGAANAAGTGTAAAAAATAGCATCCACNNTCTCACNA
AGAGGAAGANAGGAATGGCGNNCTAATGATNATNATTTATAAAAAAGNNAAGNCAATNAN
TAANNATTGGAGNGAAAAAANAGGGGGTTAAAAATCGAACAACTTACAAAACAAGNACGA
GAAAAAGGGAAGCNANNTGAGNNGGGACATAACNTANNTGAAAAAGAATTGANTANC
Quality >S03036-01_N16.phd
3 2 3 3 2 3 5 4 3 9 11 12 5 5 5 14 14
9 9 6 8 8 5 7 3 5 7 9 7 9 16 29 22 16
24 15 14 21 28 15 15 27 28 15 13 6 9 17 36 34 30
36 41 36 38 16 32 31 19 22 20 21 38 43 43 35 42 12
18 26 38 37 44 34 44 24 27 42 44 42 44 44 38 16 22
12 15 18 21 34 46 29 34 39 10 13 18 28 16 22 35 35
39 46 46 52 42 42 60 52 52 52 52 52 52 48 52 52 44
35 48 53 45 60 52 60 52 52 53 52 45 52 60 57 60 60
53 45 47 53 41 52 41 52 52 32 45 41 48 52 52 52 52
52 52 52 57 63 63 63 63 63 58 60 53 58 52 58 53 48
48 52 52 52 63 57 52 52 57 57 53 53 52 57 63 60 57
60 57 57 57 63 60 60 52 48 58 57 60 60 53 58 60 52
60 52 60 60 57 60 52 57 60 57 60 57 60 52 60 57 52
52 57 57 57 60 53 53 53 57 57 48 52 52 57 52 60 60
52 57 53 53 53 53 60 60 53 63 53 53 53 57 52 57 52
48 52 58 63 53 52 63 53 57 53 63 63 52 53 60 60 60
60 60 63 57 60 53 60 52 52 57 52 60 60 57 48 57 57
52 60 60 60 60 57 53 48 53 58 53 57 52 57 60 60 60
60 58 52 60 57 57 45 43 45 57 57 57 60 60 48 57 57
52 52 57 52 57 48 48 43 48 60 57 52 53 57 48 35 35
44 35 45 42 44 44 45 45 57 57 47 25 35 35 35 35 52
45 21 35 35 35 35 53 53 53 53 52 57 60 53 52 53 34
53 53 52 53 53 53 53 53 37 41 42 53 53 53 53 35 29
35 53 52 53 37 27 12 19 9 19 19 41 53 14 9 13 9
10 11 10 9 9 10 13 11 8 17 14 14 21 13 11 13 13
9 14 10 18 25 10 15 19 36 34 32 14 10 8 12 27 29
33 23 37 21 40 46 47 24 22 8 19 40 24 23 10 11 6
6 9 10 14 12 11 8 11 12 10 11 6 9 10 12 8 11
9 13 19 8 10 22 15 23 20 8 9 6 9 12 6 6 10
10 10 13 11 10 6 11 16 10 14 14 14 10 11 6 11 10
6 10 13 22 21 24 27 14 17 10 11 9 11 8 7 11 27
27 14 11 11 12 21 10 10 10 8 7 10 14 7 8 11 21
12 11 13 19 11 11 11 19 13 11 6 11 6 9 9 13 9
11 14 6 10 13 19 7 6 5 11 9 19 9 8 11 19 9
9 13 15 11 10 7 9 10 9 12 12 7 12 14 14 9 6
10 20 19 10 10 11 11 9 9 11 14 22 26 12 11 10 8
10 29 9 9 9 9 11 28 11 11 16 24 16 10 19 12 10
11 14 15 14 14 12 9 6 9 14 24 14 27 31 32 16 11
14 11 7 14 12 9 10 9 10 10 8 12 15 14 10 14 14
11 11 9 10 8 8 9 6 9 8 11 13 12 11 9 11 9
6 9 11 11 15 9 9 6 13 13 10 10 9 11 24 9 11
10 12 9 10 9 10 9 24 11 13 9 9 9 6 6 9 14
10 9 9 8 6 9 9 10 11 10 9 8 11 14 9 6 9
23 13 10 19 9 18 15 9 11 6 6 10 10 9 10 25 14
13 11 6 9 9 7 14 22 26 18 10 9 16 40 36 16 11
9 10 6 6 10 9 10 6 10 11 10 9 6 9 6 10 12
8 6 6 14 14 16 13 10 8 9 6 10 14 10 10 18 10
11 6 11 14 35 9 14 19 9 11 9 9 9 13 23 13 13
14 14 20 8 13 9 10 11 10 11 11 10 8 9 9 11 12
10 10 6 9 9 8 9 9 9 9 9 9 10 11 10 9 11
11 9 8 6 9 6 6 10 11 19 14 6 7 8 14 8 9
9 13 10 10 9 9 6 11 14 6 6 9 10 9 9 9 9
10 9 9 9 11 9 11 10 6 8 9 6 8