S03036-01_N18
Seqid S03036-01_N18
Sequence >S03036-01_N18.phd
NNNNNNNNNNNNNNNCCGAAANNANANAAGNGATTGGCGGCCAATCGGCCGAATTCCCAT
GGGGATCCGATTTGATATAAAAANNTATAGTCAAGATGTCTAACATGATGAATAAGTTCG
CTGAAAAATTACAAGGTAACGATGATTCCCATCAGAAGGGAAAGAACGCCAAATCCTCCA
ACAAGGAAAGGGATGATATGAACATGGACATGGGTATGGGTCATGATCAGTCCGAAGGGG
GAATGAAGATGGGCCATGATCAATCTGGAACAAAGATGAACGCTGGCAGAGGAATTGCGA
ACGATTGGAAGACTTACGAAAACATGAAAAAATAATGTTACGTTTTTTTGGGCGCAATTA
ACCAAGTCCTTTTATTTTTTTAATGGTTTATTTATGAATTGTTTATGTTTATGTTAGTTC
TTTATACTCAAAATCAATAAGTGCTTATTTTANCCAAACAANACCNNAAACCGCNNGGGA
AGAAAAAANGGGGAAGATGAAAAATTTTTTTTAGNGAATTTTTGGACCTTANGGGCNANC
TTAAGTAACATNTTTNAGGNACCTTAATTANAAAAGGAAAACACGAAACACCCTCTCCTC
CTCCCGGGGAGGGNAGGGGGGGGGAGATTTTTANTTATTTTATTAATCTATATANANGAA
GTGATAAAAACTGTGNGCATNATATGNGTNTNAGTNGAAAGAAAAATAAANTGAAGANNN
ACCNCCNCCTCCACCTCNANNNAGAGGAGNAGGGAGNGTGTATANANNATTAGAGATATG
NAGACGGNNNNNATGGTGNNNNANANCNNGCGGGAGAGAGAGGTAAGAGCAGAGAANATA
ATAGGATACCGTANAA
Quality >S03036-01_N18.phd
5 4 5 7 6 3 3 3 4 7 5 3 7 5 7 8 12
9 12 9 12 7 7 8 6 17 6 9 8 8 6 9 9 15
20 26 14 16 26 25 18 14 11 13 30 32 31 24 31 26 21
25 12 21 31 20 20 19 20 34 42 37 34 41 16 11 26 29
18 31 31 43 35 41 33 28 49 41 46 46 46 24 9 6 6
35 8 20 29 34 43 38 22 36 36 44 32 44 39 39 36 35
39 34 31 35 42 31 35 47 42 44 44 47 47 42 47 47 47
50 45 42 35 42 26 24 28 28 52 42 57 57 52 57 52 60
46 47 57 52 60 52 57 52 52 52 58 60 60 57 52 57 52
52 57 52 52 52 63 60 52 57 57 52 63 52 52 54 54 52
52 57 57 60 57 57 57 60 52 52 57 52 57 43 63 63 63
63 63 63 60 57 48 33 63 52 52 52 52 57 57 57 60 57
57 57 57 41 57 60 57 57 57 57 52 57 52 57 60 48 60
57 60 52 57 52 47 43 40 47 60 47 52 52 60 52 46 63
60 63 48 52 52 52 53 53 60 57 52 52 57 60 48 52 52
48 48 53 52 52 52 57 57 57 58 63 53 53 63 57 57 57
63 63 57 52 46 58 63 57 52 52 58 63 63 63 60 60 52
63 52 57 53 52 52 63 58 52 57 57 57 52 60 53 35 53
53 48 58 63 48 52 39 63 63 57 58 60 63 58 53 53 48
35 48 63 52 57 48 48 48 48 57 57 57 52 52 52 52 57
52 42 48 43 43 47 43 43 43 48 53 41 30 40 40 30 35
21 28 23 48 47 52 52 57 57 57 57 57 57 63 63 53 60
52 57 60 57 57 60 52 60 48 48 48 48 48 48 48 48 52
60 48 40 42 47 60 48 40 52 40 37 42 46 52 41 52 46
60 28 44 28 37 47 35 42 37 35 40 30 36 26 26 13 18
37 42 42 42 14 20 28 30 20 22 19 12 23 18 13 13 24
44 46 46 42 32 46 46 41 46 14 5 16 12 11 30 16 9
9 9 7 9 9 11 6 7 10 10 9 11 16 10 10 6 6
9 22 10 15 9 10 10 9 9 10 9 9 6 9 18 15 10
13 8 11 9 9 9 9 9 8 9 14 29 11 11 14 9 12
11 9 9 9 7 10 15 10 10 10 17 9 9 10 16 10 10
14 11 10 9 6 9 47 12 16 6 11 6 12 11 15 9 13
9 11 10 9 9 9 16 7 16 9 9 7 9 9 9 6 18
16 12 19 17 21 11 15 9 9 7 10 11 11 8 9 15 10
13 10 12 13 17 9 11 11 16 11 12 14 11 10 13 14 16
8 20 31 9 31 33 9 30 8 10 16 14 10 9 9 9 9
17 7 10 15 15 18 11 15 32 22 24 31 13 17 10 11 13
24 19 16 18 7 9 9 11 14 17 27 27 9 9 13 12 10
18 14 13 17 14 28 26 9 7 13 7 8 12 12 11 14 11
16 10 14 17 22 8 10 10 12 14 9 16 7 14 12 8 9
7 10 43 13 13 9 6 10 13 6 9 7 11 16 8 6 9
15 13 24 8 30 10 35 33 17 16 16 11 16 7 13 19 11
15 16 8 6 6 7 16 10 10 6 11 28 7 30 29 8 21
29 14 22 16 10 9 6 9 7 7 7 11 10 10 12 9 10
21 7 9 11 17 18 15 10 7 18 10 13 17 28 12 9 6
10 5 6 28 24 12 18 14 9 9 11 11 12 9 9 7 15
11 16 8 17 18 7 7 6 7 7 9 10 8 14 20 9 7
6 6 6 9 7 12 7 9 6 6 9 10 9 11 16 16 16
11 16 10 9 13 10 16 16 14 11 11 14 14 8 14 10 9
12 21 9 7 11 8 25 31 20 20 9 9 17 8 10 9 10
10 12 10 6 10 19