S03036-01_N19
Seqid S03036-01_N19
Sequence >S03036-01_N19.phd
CNNNNNNNNNNNNNNNAGGNCGANANATAGGGNGATTGGCGGCCAAATCGGCCGAATTGA
TAGAATAAAAAACCAAGGATAACAAACATCTTCTTTCGTTCGCTTCAAAATAACTACAAA
TTAAAAATGCAATTCTCTACCGTCGCTTCTATCGCTGCTATTGCCGCTGTTGCCTCCGCC
GCTTCTAACATTACCACTGCTACTGTCACAGAAGAATCTACCACTTTGGTCACTATCACT
TCCTGTGAGGACCACGTTTGTTCTGAAACAGTTTCCCCAGCTTTGGTTTCCACTGCTACC
GTCACCGTAAATGACGTTATCACTCAATACACCACCTGGTGTCCATTGCCAACCACTGAA
GCACCAAAGAATACCACTTCTCCAGCTCCAACTGAAAAGCCAACCGAAAAGCCAACTGAA
AAGCCAACTGAAAAGCCAACCCAACAAGGTTCTAGCACTCAAACTGTTACCTCCTACACT
GGTGCCGCTGTTAAGGCTTTGCCAGCTGCCGGTGCTTTGTTGGCTGGTGCTGCCGCTTTA
TTGTTGTAATTTACTCAACCTTTTCTTTAATATATTTTTAGAAAAATGGTTAAGTACTTT
TCCGTCAATACAGCTTCCACAAAATCCTTTTATTTTCAATTAATANGATATTTCTGGTAA
TTTCTTAATCTAATTCTAGGAGGCAACACTCCATAACTAAATGTTTATTATAATAATAAT
ATATAAAGTTAATATCTCCTTAGGTTGNAGNAGGGAGAGGAGGGGGGAAAAGGGGAGGGA
GATNCANAAGGATNACACAAAAAAAAGAGAGAAGGAGAGAGAAAAAGAAAAGATAAANAA
GGGNGCNGGACTAAGGAGGGCCCACNGGAGATTTCTNGAGGGGCCACAGAAAGGCGGAGG
GGGNAAAGANGGGAG
Quality >S03036-01_N19.phd
9 7 5 3 3 3 4 5 4 4 6 7 5 5 5 5 8
11 8 7 9 9 10 7 9 5 8 8 9 11 17 21 6 22
22 18 29 33 15 9 30 17 9 20 12 15 16 32 32 30 24
29 24 26 16 15 23 27 26 11 25 20 28 23 31 24 31 28
27 18 21 28 21 28 30 35 46 49 18 17 32 34 30 28 20
28 30 19 31 33 37 36 43 49 40 40 42 32 35 29 29 31
23 26 21 21 15 18 26 24 26 18 19 25 21 19 27 19 36
39 42 44 42 42 42 43 50 44 50 46 43 49 50 51 50 54
50 44 60 47 60 49 47 47 47 47 47 47 50 47 54 60 54
50 42 42 49 50 33 47 50 47 49 47 47 47 42 44 50 60
33 43 39 47 47 59 60 54 60 47 60 50 49 42 47 44 47
54 54 50 47 44 47 63 43 44 47 50 51 49 42 50 50 49
63 45 43 60 60 52 52 52 57 52 52 52 52 57 52 57 45
63 46 52 57 60 44 43 41 40 60 46 52 46 42 47 34 39
35 47 40 39 34 34 57 44 52 52 52 63 35 42 63 57 54
57 57 60 46 57 54 52 52 60 57 52 52 57 60 46 60 60
60 57 60 63 63 63 44 50 60 57 51 43 45 63 47 60 58
49 50 44 45 52 58 60 50 50 50 58 60 49 49 42 49 49
60 49 47 50 49 47 51 50 39 50 50 50 47 42 60 39 50
50 49 39 51 49 50 54 39 49 51 39 49 53 44 51 57 44
54 39 42 46 35 49 49 50 22 49 29 49 49 49 42 43 33
49 36 49 50 39 42 33 49 40 40 49 50 49 49 41 50 50
54 43 54 54 57 54 50 50 51 35 49 54 54 33 49 30 50
50 54 54 54 49 49 50 43 43 51 30 54 50 50 54 57 59
57 57 42 38 54 32 40 35 49 54 46 49 49 49 46 28 59
30 57 35 59 59 38 57 57 54 38 46 59 35 59 35 54 54
35 59 35 23 50 31 43 13 57 37 32 38 41 32 35 35 46
31 31 50 49 35 35 43 18 52 36 33 52 35 30 52 41 35
41 30 41 35 35 53 31 46 21 52 43 19 52 41 16 51 21
49 26 42 16 46 49 49 35 20 49 21 28 30 41 32 30 52
31 51 35 34 32 28 52 33 28 19 28 32 50 28 41 37 49
15 49 30 30 36 22 30 31 30 20 38 46 26 12 49 50 12
46 50 15 34 37 13 46 40 30 30 36 30 14 42 24 50 25
46 46 46 26 12 49 34 11 34 22 29 35 19 10 40 46 35
30 26 24 28 34 51 49 50 23 42 42 12 37 21 50 23 30
30 21 25 32 40 38 16 46 26 18 21 17 32 30 30 41 30
18 15 16 30 30 41 20 18 10 21 28 28 17 18 21 16 29
34 26 18 16 21 18 21 18 15 31 20 36 15 13 17 8 7
9 36 12 21 11 21 19 20 24 33 35 19 28 37 26 34 31
26 16 21 22 9 41 31 16 18 33 18 31 18 17 23 23 21
27 18 31 14 21 21 15 18 14 18 20 30 16 22 21 23 25
18 28 30 19 13 18 17 21 23 15 19 16 13 11 21 18 15
22 30 9 16 8 14 17 9 11 13 22 44 44 30 28 20 21
22 15 14 11 15 9 16 15 23 20 20 29 50 18 21 11 6
10 13 7 9 13 17 8 10 14 14 18 18 11 12 10 18 23
21 26 11 9 11 10 8 22 15 18 15 17 9 10 8 14 14
9 6 9 14 7 11 9 17 18 28 13 7 27 8 11 11 12
13 12 21 17 16 25 10 17 12 24 32 19 15 11 16 10 28
19 18 24 22 28 9 13 17 14 11 11 15 22 10 16 10 17
17 22 10 9 7 19 23 10 15 14 6 12 8 7 11 17 12
15 11 13 46 21 13 19 21 11 9 9 9 10 11 10 7 9
19 12 17 20 11 15 11 11 10 7 11 26 13 26 10 8 11
14 21 14 11 16 20 26 24 16 20 8 16 11 15 36 26 33
33 24 7 15 16 11 11 13 6 12 19 11 15 9