S03036-01_N20
Seqid S03036-01_N20
Sequence >S03036-01_N20.phd
NNNNNNNNNTTNNNNNNNNCNNNANNTANGGNGATTGAGCGGCCAAATCGGCCGAATTGG
GCGCACTCTTCATTCGATAGGGGCTCAAGTCACCAACTACAATAAATTACATTATACTAT
AACATGTCATCTGCTCTATACAAACAAAACACAAATTTTACTCATTCTACCGGTTCTTTC
TTGCAAAGCGCACCTGTTGAACTGACGACAGTCAGTGGGTACCAGGAGTTTTTGAAGAAG
CAAGAGAAAAAGAACTATGAAATTCAAACAGTTTTAAGCGAGGATAAATCACATGGTTAT
GTGCTAAAGGACGGCGAAGTCATCGCTAATATCATTGGTGAGGCCAAAGATTATCTTTTG
GATTTGGCCGGCCAGGCTTGAACGAGTGGCTAAATATTTGTTCGATACGAGTCACTTCAT
GCACACTTTGATTTGCACTCTTATTGCTGGGCTGTAGTTTTCTTTTCCGTTTTCGCTTAT
AAATCTAACATGTTCTATTAGGGGAAAGAAAGGCGCANATTGTAGAGTTTGNTANGNCTT
TAAAGTACTTGATTTCACCCACCGAAAGGNNAAGAAATAAAANAAAGATAAAGCCCNNTN
ATTACCCACAACCAGTAATGGGGTGAAACGTTTGTATGGTNGCNNTAATGTTTTTAAAAG
AAATNGGAAGNANAGGGAGCACACCCATNGGGGGGGGTAAAAAAATAAGATGNAAAAAAT
CNTTTTTCNAANNAAAGNANAAGGAAAAGAAGGAAAGANGGGGTAGANAAAAGAAAANGA
GTGANAAAAANCGGGTTTTGGNGATGTTTATAGAGAGCGATATAANNNGAAATAAAAAAA
NTNNNACAACATNCGAAGANAANAGAANAANATNNCNAAN
Quality >S03036-01_N20.phd
4 3 3 3 5 3 3 5 6 8 8 6 6 7 6 6 7
7 5 9 6 5 6 12 3 5 8 10 5 15 14 6 18 27
25 27 25 9 16 14 29 26 17 18 15 14 18 35 29 31 25
31 30 26 23 12 23 29 28 16 15 18 24 34 28 25 41 43
49 32 31 20 30 35 34 30 35 32 46 41 49 49 31 42 41
41 21 28 32 42 50 41 42 35 27 32 35 31 26 29 17 32
36 35 29 32 29 29 28 33 20 29 23 30 30 32 36 38 42
42 42 35 35 32 42 49 46 41 42 49 57 54 50 41 43 50
42 42 50 43 54 36 50 50 51 42 50 50 54 54 50 59 54
54 54 59 54 51 50 51 51 51 52 50 46 43 49 44 54 50
54 49 51 51 53 53 53 53 53 49 53 47 51 54 50 50 50
54 50 50 54 50 44 43 43 53 51 51 53 53 43 45 63 63
45 50 60 51 49 47 50 49 49 47 50 50 52 49 49 49 47
45 50 47 54 49 45 50 54 60 60 47 60 47 40 32 40 49
38 32 47 39 32 47 58 50 50 60 60 60 54 60 58 57 52
52 57 57 57 52 57 52 52 57 52 57 46 46 57 52 57 57
60 60 44 46 63 57 58 52 63 46 41 37 32 57 63 45 49
54 60 60 54 60 58 51 50 50 60 50 58 49 63 47 50 47
49 50 47 58 45 38 60 63 47 47 43 47 44 54 60 60 49
63 58 51 50 49 63 60 51 49 58 60 50 49 58 42 47 60
50 47 45 39 43 35 47 60 60 44 31 49 46 47 49 49 60
49 60 49 47 50 47 60 60 49 45 35 60 51 58 44 49 60
49 63 60 63 51 49 45 47 47 42 42 35 49 49 40 42 47
42 60 60 60 60 49 60 43 47 49 60 49 47 47 42 47 49
47 60 60 60 50 60 50 60 60 49 47 49 60 49 42 60 49
49 60 60 46 47 44 34 60 51 50 54 54 50 49 60 60 49
47 44 58 54 44 50 57 47 43 57 60 60 46 57 47 60 57
52 52 57 47 42 43 46 47 43 20 34 34 34 47 57 19 42
47 35 34 26 21 35 35 44 47 42 35 29 28 35 34 36 24
28 39 29 42 39 42 35 25 43 43 47 47 35 35 42 40 39
42 34 47 28 9 16 12 7 12 20 41 28 31 31 31 44 21
18 18 23 29 7 10 10 7 12 6 16 17 10 10 8 11 34
42 29 35 31 16 20 18 22 11 24 44 33 18 9 14 12 31
33 26 21 18 21 9 9 9 6 6 9 10 34 26 10 12 17
16 10 13 21 6 15 29 28 14 30 12 8 14 13 10 11 8
8 6 6 12 7 10 9 25 12 18 16 9 10 9 13 13 11
10 9 16 9 9 10 10 10 35 20 13 8 9 9 16 12 9
22 11 9 22 20 9 8 9 9 8 10 7 9 9 7 7 10
11 9 13 11 9 11 12 9 13 35 28 18 30 17 28 18 18
8 6 9 11 10 22 10 7 18 7 11 11 8 10 26 10 10
14 11 9 10 9 10 10 13 6 9 10 19 24 26 11 22 16
15 24 9 9 15 18 14 14 13 10 10 10 11 8 9 6 28
17 19 10 13 13 9 8 6 11 13 13 9 11 9 6 29 22
6 6 14 20 11 9 6 9 7 8 9 9 8 11 15 11 10
9 9 10 9 10 10 14 11 11 15 7 9 11 11 13 10 9
11 14 6 11 14 24 19 11 13 11 14 9 6 14 9 8 10
11 11 6 26 14 8 9 19 7 8 11 8 10 12 9 11 10
18 10 7 9 9 9 9 14 8 16 20 8 14 11 20 12 9
15 11 10 10 9 16 11 11 11 7 6 6 9 16 42 13 10
9 23 10 14 9 12 10 6 8 6 6 6 10 10 9 11 9
9 9 6 9 10 14 15 11 9 6 10 11 6 8 11 8 9
6 9 11 6 11 9 6 6 8 6 9 11 6