S03036-01_N22
Seqid S03036-01_N22
Sequence >S03036-01_N22.phd
NNNNNNNNNNNNTNNGGNNCCATNNNNNNAGGNGATTGGCGGCCAAATCGGCCGAATTGA
GAATAAAAAGATACCATCTTATACACACACATACACACACAAAGAAGCATAGACATCGTA
TACATATATTTTAAGTTTTACTAATGCCTTCTTCTCTGACAAAAACCGAACCTAACTCAG
ATCCTCGAACAAACATACAGCAGGTACCAAAAGCCTTGGACAAAAATGTAACTAATAGCG
GCAACTTGGATTCGACTTCTTCTTCGACAGGGTCGATAACAGAGGACGAAAAAAGATCAG
AATCGAATGCAGATTCCAATAACATGACAGGGGGCGAGCCAATTGACCCAAGAGATCTCG
ATTGGGACGGGCCCGATGACCCAGACAATCCGCATAATTGGTCCTCTTTGAAGAAATGGT
ATACTACTATGACTTCAGCTTTTCTTTGTTTGGTCGTCACAATGGGTAGTTCCCTNTATG
TTTCTTCCGTACCAGAATTNGAAGAAAGATAATACGTTAACTCAAAATGTGCCGCTTGAA
GNTTTACNGGTGTGNCTAAAGGGGGTGAGCAACAGTCATCGGGGGAAAATAAAAGNAAAT
ACGGGGCTANATCNNGGNCGNANAATNNGGTTTANCNNTNANNNATACTATACAAAAAAA
TGTCATACAAACANAAGAAGAACGAGTNNTAGGAATGCAGATAGGAGGGAAANGTACNNN
GTGGTCAATGNNANANAANNGGAAGAGGGTAATCNNCTNNATAGNNGAGAANAAGNAGAN
TANANAACAAACTGACNNAAAAANNGCGATGNGGCGGTGAGACNGTCCANNAGAGTNGTT
CAACTAATANTTGGAAATNNGTTTAACATNCCAGTCNNGGNTTNNN
Quality >S03036-01_N22.phd
7 4 4 3 6 6 5 5 5 3 3 7 9 5 3 11 11
5 7 8 8 9 8 5 7 5 5 5 6 8 27 21 7 21
26 10 20 29 17 12 43 28 15 25 13 12 18 29 30 49 28
34 32 26 20 15 31 34 22 18 16 28 15 12 35 38 32 30
28 32 21 13 30 32 30 33 44 39 42 38 50 42 42 44 32
45 44 50 44 50 44 47 44 50 44 50 39 44 35 52 32 39
39 42 52 60 60 47 33 39 35 42 46 60 34 42 39 47 42
46 47 42 47 39 40 47 60 52 52 57 60 52 57 52 57 60
60 60 52 60 52 52 52 60 57 57 57 60 57 52 57 58 63
63 58 63 63 63 53 60 52 57 60 60 57 63 58 60 52 57
52 57 52 57 57 52 63 63 52 57 63 57 63 63 58 63 57
63 63 60 57 57 63 63 57 63 58 63 63 63 63 57 52 63
52 57 52 63 52 63 63 63 63 57 63 60 57 63 57 52 57
60 59 59 58 59 63 58 60 57 57 52 52 52 52 60 57 57
57 63 35 40 23 23 21 40 44 52 57 52 52 52 52 57 58
52 63 63 60 58 63 59 60 57 57 58 63 57 60 52 63 58
58 63 57 63 57 57 63 60 52 58 52 46 63 52 32 57 63
60 60 60 57 52 58 52 47 63 52 59 63 57 52 60 59 63
60 57 63 60 45 57 63 47 63 60 52 44 57 57 57 60 52
46 57 57 63 60 57 57 63 52 58 52 52 60 54 47 57 52
42 57 52 57 41 39 42 57 42 29 41 43 52 44 52 39 57
57 57 60 52 52 57 57 47 43 41 35 60 63 58 44 57 60
60 58 60 53 52 46 57 57 57 47 63 47 42 63 48 57 57
52 46 57 47 47 48 35 60 57 48 40 57 53 52 57 60 60
57 43 41 33 30 58 53 43 35 57 52 57 47 57 46 52 57
60 57 52 52 48 57 52 39 60 43 48 28 35 48 60 57 48
57 46 42 40 43 48 35 46 60 48 44 42 53 45 47 30 18
45 21 35 35 45 30 28 30 28 20 36 47 39 33 45 11 6
11 29 46 33 29 16 20 26 26 39 21 26 31 20 28 27 20
16 19 35 17 18 11 6 11 11 17 16 53 34 16 11 42 13
11 11 9 16 18 20 21 11 9 10 10 13 18 28 8 18 9
13 9 9 9 11 10 14 14 14 15 11 9 8 12 6 9 19
20 14 9 6 8 9 14 14 11 10 7 10 12 11 10 9 13
17 46 37 12 14 10 9 9 9 10 20 15 9 11 24 10 9
15 10 9 18 14 9 13 14 11 11 10 13 10 14 13 10 14
7 13 11 9 11 14 11 11 9 19 12 14 11 9 7 19 14
10 7 7 10 15 7 15 11 7 9 7 10 24 11 7 6 9
10 9 12 11 14 6 9 7 7 9 7 10 6 7 6 14 8
9 11 14 10 13 13 16 11 12 12 21 11 16 10 11 16 17
12 9 15 18 13 11 10 10 11 11 7 15 15 9 9 14 10
23 12 9 12 11 10 11 6 7 9 10 11 8 9 9 14 14
11 18 9 14 11 11 10 16 15 10 12 14 14 10 8 7 11
11 17 9 6 6 6 14 9 10 13 10 10 11 16 11 11 7
6 9 6 9 6 9 10 6 7 10 16 13 18 19 10 11 9
9 11 12 12 10 9 6 7 14 11 6 6 11 13 11 9 6
6 19 9 9 8 9 6 9 19 12 6 8 9 11 6 9 8
6 8 7 14 11 9 11 11 10 9 8 11 14 10 6 6 8
12 11 11 11 7 7 8 11 9 9 10 9 7 9 10 11 9
12 11 10 11 11 12 8 6 11 9 11 9 9 6 6 9 13
9 10 9 6 10 9 10 11 10 8 9 9 11 11 10 9 6
11 9 9 8 9 11 10 9 7 6 9 9 10 9 19 20 14
14 10 6 9 9 13 11 11 9 5 6 8 11 5 8 10 7
6 5