S03036-01_N23
Seqid S03036-01_N23
Sequence >S03036-01_N23.phd
GGNNNTTNNNNNNNNGGGCTCNNNNANNNNANNATCGACGGCCAGTCGGCCGAATTGANA
ACGCTTCTGGTGGTGTAAATACGGAGAAGTCACCTTAAATAGTTTTGTTCTGATAATTGC
ATTTTTTTGGAAAGATTTGGCTGCTTAAAAGATTCAAGCAATCAAGAGAAACATTACAAG
GCCTGCTTGGCCGGTCTACTAGGCTGAAATAATAAGTTTCTGATTATGGTTATCACGGTA
AATGACTACGAAAGGGTAAAGCAACGAATGGTTGTTTTATGGTAAGAATACTTTGGCGAA
TCAACAAATTGAAGTTGCGCAATGTACAATTCGCTTANCTATCNCAACGGGGTAAANAAT
GGGTAGGAAATCATATATATAAAANAAAAAAATATCGTACACCTCTTAAAGAACANCAGG
AATTAANTGNANAATAAGAAAAAAAAAAAAATTCCCCCTCTNNCTNCGNCNGNGCCGATG
GTGGGGNGGAGGTAATTTTTTTNANTTNTTTTGNTTAAAAAAAANNTNAATAGGTAGCCC
CCNNGGCGCGTNCCACATAGNAAAAAANNGGAAANCAAACATANNNNCTANNNTNGTGGA
GGGGNGGGGTNGTNTTGTTNGTGGGNNNTNCNNATGNNAGGNAAGAAGGNAAGAAGGNGG
GCTGCTGTTGGNTAAGTAGGNGGAGANNGNCNAGCACCTACCCNANCNNCCCCNTTNCGG
GNGCGGGTNNGGGGTGGGAGANGNNTTAAGTGTGCGTAGNCNGANAGNAAAGNTGNAGCA
ANNNNANGGAACCNNGCTCGGAAAGGGAGAGGANGGNNGTCTANAANCCCACNNACCAGA
NGCATCNGTTNTNTNAGN
Quality >S03036-01_N23.phd
21 20 7 4 5 10 11 5 5 5 3 3 3 3 5 12 13
13 12 9 8 6 5 5 5 9 7 3 3 5 8 5 7 9
11 9 14 9 12 11 12 11 11 10 8 9 9 17 17 12 18
10 14 9 32 11 9 9 6 13 11 16 12 21 21 27 21 27
24 21 16 24 17 11 17 11 29 26 29 22 29 28 10 17 18
10 39 34 19 35 40 11 52 24 13 10 12 11 10 26 24 23
18 29 21 23 39 13 13 28 19 36 37 30 23 26 19 45 45
32 26 41 53 53 53 35 35 39 38 37 42 33 35 27 52 41
42 38 38 37 53 53 53 53 53 53 53 53 53 53 24 37 28
44 53 42 37 53 53 35 42 47 42 32 41 35 37 24 35 42
42 47 28 53 45 40 42 24 17 20 38 26 42 44 60 53 53
46 46 46 46 46 53 53 46 46 46 53 38 38 46 37 46 42
42 46 35 31 40 40 40 40 41 40 29 31 41 31 30 40 25
32 53 33 40 47 40 53 30 18 24 28 28 41 37 32 40 53
18 24 38 53 53 44 42 35 37 35 46 18 38 40 28 19 40
30 42 52 53 44 47 53 41 53 46 14 53 53 46 53 53 53
53 46 42 53 53 46 53 42 46 42 24 37 37 37 53 53 53
32 50 40 42 53 53 32 18 19 35 40 42 26 33 19 28 23
23 40 40 42 46 53 37 28 35 40 23 35 30 40 35 42 30
31 12 10 14 10 21 14 19 24 9 16 19 18 9 6 10 13
10 16 18 7 10 10 9 10 10 10 13 9 11 9 10 9 7
11 9 10 14 10 8 9 11 14 11 11 9 10 9 9 10 13
11 9 8 19 9 16 8 10 9 11 6 8 11 18 18 26 19
28 24 25 27 29 22 11 20 17 22 33 27 32 24 23 34 28
21 16 12 21 14 8 9 7 11 10 9 8 8 11 12 10 8
13 7 10 9 6 9 6 9 10 9 10 11 10 14 34 26 20
13 21 12 43 35 32 28 28 11 12 10 13 23 14 9 9 9
9 13 7 7 10 8 6 9 8 6 10 7 9 7 10 10 13
11 10 9 12 16 9 16 9 12 13 6 8 10 8 9 18 8
10 9 9 9 10 19 16 12 10 7 8 6 22 11 6 16 19
12 13 8 6 9 8 15 17 33 19 14 14 12 9 7 6 8
7 8 10 16 9 9 9 9 9 11 11 9 9 12 10 6 6
9 11 11 9 9 9 9 6 9 9 10 9 9 9 14 9 6
9 9 9 9 16 18 6 6 9 9 11 15 9 6 9 10 13
9 9 9 9 9 7 7 6 7 9 9 10 7 6 7 9 6
11 8 11 11 8 23 12 21 15 6 9 10 8 9 9 7 8
9 6 9 11 9 9 8 6 11 11 9 8 14 7 7 6 9
7 9 6 6 10 13 10 6 6 11 9 12 7 9 9 9 10
8 9 11 7 12 11 11 11 8 8 18 6 16 12 19 8 8
9 9 10 9 11 10 16 11 6 10 9 13 9 9 16 16 17
6 9 22 31 20 26 7 7 9 7 8 6 9 10 9 16 10
12 9 10 13 9 9 6 8 6 10 6 6 9 10 16 9 6
8 8 7 10 9 12 9 6 11 9 8 13 11 9 6 6 9
9 13 11 9 9 11 11 11 8 14 6 16 6 6 18 9 9
9 11 9 9 9 8 10 9 9 9 10 6 16 7 9 20 6
11 9 6 8 11 9 11 6 9 11 6 11 13 9 9 11 6
7 7 6 8 6 9 10 10 9 8 8 6 6 8 11 10 9
14 13 9 8 9 9 9 19 31 34 18 12 19 9 6 9 11
6 6 8 11 13 11 8 6 11 10 6 16 11 14 9 8 7
6 9 11 9 11 9 11 6 13 9 10 11 9 6 11 9 9
6 13 6 11 6 8 9 5